Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627256_s_at:

>probe:Drosophila_2:1627256_s_at:597:107; Interrogation_Position=119; Antisense; AGAAGAGCAGCTTCGGCGCCTTCAA
>probe:Drosophila_2:1627256_s_at:143:321; Interrogation_Position=134; Antisense; GCGCCTTCAAGACCAAGTCGGACAT
>probe:Drosophila_2:1627256_s_at:184:557; Interrogation_Position=153; Antisense; GGACATCTATGTGCGCGCCGTGCTG
>probe:Drosophila_2:1627256_s_at:671:157; Interrogation_Position=218; Antisense; ACAAGAAGCTTGTGCCAGTGGCCGG
>probe:Drosophila_2:1627256_s_at:500:555; Interrogation_Position=241; Antisense; GGACTCGTCGATAGCTTCCAGAAGC
>probe:Drosophila_2:1627256_s_at:476:487; Interrogation_Position=267; Antisense; GTACGAAGCCCTGAAGGTGCCCTAT
>probe:Drosophila_2:1627256_s_at:276:503; Interrogation_Position=309; Antisense; GTCCCAGGTGGATGCCGAGATCAAG
>probe:Drosophila_2:1627256_s_at:647:69; Interrogation_Position=365; Antisense; AGGCCTCGGAGCAGCGCATTCAGAA
>probe:Drosophila_2:1627256_s_at:666:623; Interrogation_Position=425; Antisense; TGCCCTACGACCAGATGACCATGGA
>probe:Drosophila_2:1627256_s_at:186:55; Interrogation_Position=439; Antisense; ATGACCATGGAGGACTACCGCGACG
>probe:Drosophila_2:1627256_s_at:146:421; Interrogation_Position=526; Antisense; GAGCAGGTCGGCTACAAGTCCAAGG
>probe:Drosophila_2:1627256_s_at:192:661; Interrogation_Position=583; Antisense; TAAACCGGAGCGCACGAGGAGCACT
>probe:Drosophila_2:1627256_s_at:54:77; Interrogation_Position=599; Antisense; AGGAGCACTCTGACACTGGCTTCGT
>probe:Drosophila_2:1627256_s_at:265:291; Interrogation_Position=621; Antisense; CGTTGGTCGTCTGTTCGATTCGAAA

Paste this into a BLAST search page for me
AGAAGAGCAGCTTCGGCGCCTTCAAGCGCCTTCAAGACCAAGTCGGACATGGACATCTATGTGCGCGCCGTGCTGACAAGAAGCTTGTGCCAGTGGCCGGGGACTCGTCGATAGCTTCCAGAAGCGTACGAAGCCCTGAAGGTGCCCTATGTCCCAGGTGGATGCCGAGATCAAGAGGCCTCGGAGCAGCGCATTCAGAATGCCCTACGACCAGATGACCATGGAATGACCATGGAGGACTACCGCGACGGAGCAGGTCGGCTACAAGTCCAAGGTAAACCGGAGCGCACGAGGAGCACTAGGAGCACTCTGACACTGGCTTCGTCGTTGGTCGTCTGTTCGATTCGAAA

Full Affymetrix probeset data:

Annotations for 1627256_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime