FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627257_at:

>probe:Drosophila_2:1627257_at:64:63; Interrogation_Position=1282; Antisense; ATGTCCACGCATTGGTGCATACTGA
>probe:Drosophila_2:1627257_at:639:97; Interrogation_Position=1358; Antisense; AGATGCGATGGTTTCGCTGGCTCTA
>probe:Drosophila_2:1627257_at:303:333; Interrogation_Position=1373; Antisense; GCTGGCTCTACATTTACTTCTCGCG
>probe:Drosophila_2:1627257_at:622:149; Interrogation_Position=1388; Antisense; ACTTCTCGCGCTACATGTTTATCAA
>probe:Drosophila_2:1627257_at:102:61; Interrogation_Position=1402; Antisense; ATGTTTATCAATTCGATGCGTCAGA
>probe:Drosophila_2:1627257_at:414:447; Interrogation_Position=1416; Antisense; GATGCGTCAGATAAATCTCTCGGAT
>probe:Drosophila_2:1627257_at:343:191; Interrogation_Position=1512; Antisense; AACTACCTTCATGATCGGATGCTCC
>probe:Drosophila_2:1627257_at:463:661; Interrogation_Position=1569; Antisense; TAAACTCTGACGATTCTACTAGTAT
>probe:Drosophila_2:1627257_at:622:483; Interrogation_Position=1600; Antisense; GTATGTAACTACTACTGTTGGCCAA
>probe:Drosophila_2:1627257_at:270:143; Interrogation_Position=1613; Antisense; ACTGTTGGCCAAACGATCGATAGTA
>probe:Drosophila_2:1627257_at:385:111; Interrogation_Position=1674; Antisense; AGAATCAGCGAAGCGGCAGTACCAT
>probe:Drosophila_2:1627257_at:614:567; Interrogation_Position=1688; Antisense; GGCAGTACCATAGGCAACCGAAACC
>probe:Drosophila_2:1627257_at:564:27; Interrogation_Position=1797; Antisense; ATACTCAGTCCAAGCAATGTTCCAA
>probe:Drosophila_2:1627257_at:98:517; Interrogation_Position=1823; Antisense; GTGTGCGATGTAGTCAAGTGCTTTA

Paste this into a BLAST search page for me
ATGTCCACGCATTGGTGCATACTGAAGATGCGATGGTTTCGCTGGCTCTAGCTGGCTCTACATTTACTTCTCGCGACTTCTCGCGCTACATGTTTATCAAATGTTTATCAATTCGATGCGTCAGAGATGCGTCAGATAAATCTCTCGGATAACTACCTTCATGATCGGATGCTCCTAAACTCTGACGATTCTACTAGTATGTATGTAACTACTACTGTTGGCCAAACTGTTGGCCAAACGATCGATAGTAAGAATCAGCGAAGCGGCAGTACCATGGCAGTACCATAGGCAACCGAAACCATACTCAGTCCAAGCAATGTTCCAAGTGTGCGATGTAGTCAAGTGCTTTA

Full Affymetrix probeset data:

Annotations for 1627257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720