Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627258_at:

>probe:Drosophila_2:1627258_at:684:397; Interrogation_Position=1050; Antisense; GACACTTGTCACATGTTTGGCCAAA
>probe:Drosophila_2:1627258_at:175:691; Interrogation_Position=1065; Antisense; TTTGGCCAAAAAGGCGCGCACGTGA
>probe:Drosophila_2:1627258_at:583:417; Interrogation_Position=1137; Antisense; GAGCTAGCAGCCATATTCAAAATTG
>probe:Drosophila_2:1627258_at:44:663; Interrogation_Position=1167; Antisense; TAAACGTTCGCACGTACCGAGCATA
>probe:Drosophila_2:1627258_at:332:183; Interrogation_Position=638; Antisense; AAAAGCGGGCCATCAGGAGTAGCTG
>probe:Drosophila_2:1627258_at:224:429; Interrogation_Position=654; Antisense; GAGTAGCTGGAATGCTCGCTTTTTA
>probe:Drosophila_2:1627258_at:504:341; Interrogation_Position=671; Antisense; GCTTTTTAATTGACATTTGCTCGAG
>probe:Drosophila_2:1627258_at:483:337; Interrogation_Position=689; Antisense; GCTCGAGTTGAGTTGCGTTTTGTTC
>probe:Drosophila_2:1627258_at:49:255; Interrogation_Position=843; Antisense; CAGACGACGTCGACCCGGAATAGAA
>probe:Drosophila_2:1627258_at:585:179; Interrogation_Position=887; Antisense; AAAAATTCAGCATCAACCTCGCCAG
>probe:Drosophila_2:1627258_at:245:35; Interrogation_Position=944; Antisense; ATCAGCAGCCGTGTGCAATGGCATT
>probe:Drosophila_2:1627258_at:591:361; Interrogation_Position=958; Antisense; GCAATGGCATTTGAGCACGCTGCTT
>probe:Drosophila_2:1627258_at:31:335; Interrogation_Position=976; Antisense; GCTGCTTGAGCAATGGCCGCCGGAC
>probe:Drosophila_2:1627258_at:116:317; Interrogation_Position=994; Antisense; GCCGGACCGGAAACGCAGCCATTGC

Paste this into a BLAST search page for me
GACACTTGTCACATGTTTGGCCAAATTTGGCCAAAAAGGCGCGCACGTGAGAGCTAGCAGCCATATTCAAAATTGTAAACGTTCGCACGTACCGAGCATAAAAAGCGGGCCATCAGGAGTAGCTGGAGTAGCTGGAATGCTCGCTTTTTAGCTTTTTAATTGACATTTGCTCGAGGCTCGAGTTGAGTTGCGTTTTGTTCCAGACGACGTCGACCCGGAATAGAAAAAAATTCAGCATCAACCTCGCCAGATCAGCAGCCGTGTGCAATGGCATTGCAATGGCATTTGAGCACGCTGCTTGCTGCTTGAGCAATGGCCGCCGGACGCCGGACCGGAAACGCAGCCATTGC

Full Affymetrix probeset data:

Annotations for 1627258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime