Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627259_a_at:

>probe:Drosophila_2:1627259_a_at:393:563; Interrogation_Position=4929; Antisense; GGAACCATTCGATCGATTCGAATCA
>probe:Drosophila_2:1627259_a_at:269:365; Interrogation_Position=4975; Antisense; GAATCACTCGAATCACTTAAGCAAA
>probe:Drosophila_2:1627259_a_at:429:209; Interrogation_Position=4993; Antisense; AAGCAAACCAACATTGTGACTTTGA
>probe:Drosophila_2:1627259_a_at:107:283; Interrogation_Position=5041; Antisense; CTCCTTTTGCGGAGGATACGGAATT
>probe:Drosophila_2:1627259_a_at:82:61; Interrogation_Position=5085; Antisense; ATGTATATTTTTGCGTAGTCCTAAG
>probe:Drosophila_2:1627259_a_at:207:279; Interrogation_Position=5128; Antisense; CTAGCTGAATTAGTACCCACTGTAT
>probe:Drosophila_2:1627259_a_at:652:703; Interrogation_Position=5137; Antisense; TTAGTACCCACTGTATCATGCTACC
>probe:Drosophila_2:1627259_a_at:384:133; Interrogation_Position=5159; Antisense; ACCCCACTTCACTTTGCTGTGCAAA
>probe:Drosophila_2:1627259_a_at:514:333; Interrogation_Position=5174; Antisense; GCTGTGCAAATCTCTCTCACTTGAG
>probe:Drosophila_2:1627259_a_at:142:255; Interrogation_Position=5191; Antisense; CACTTGAGAAAACTCGAGTTCCCTT
>probe:Drosophila_2:1627259_a_at:468:231; Interrogation_Position=5329; Antisense; AATGCTTTGAGCAACACTCACACAA
>probe:Drosophila_2:1627259_a_at:498:99; Interrogation_Position=5414; Antisense; AGATGTTAAGAGCTACCAACCGAAC
>probe:Drosophila_2:1627259_a_at:73:1; Interrogation_Position=5431; Antisense; AACCGAACAAGCTGCAAACGTTGGC
>probe:Drosophila_2:1627259_a_at:239:177; Interrogation_Position=5446; Antisense; AAACGTTGGCATTTATTTGTCTTCA

Paste this into a BLAST search page for me
GGAACCATTCGATCGATTCGAATCAGAATCACTCGAATCACTTAAGCAAAAAGCAAACCAACATTGTGACTTTGACTCCTTTTGCGGAGGATACGGAATTATGTATATTTTTGCGTAGTCCTAAGCTAGCTGAATTAGTACCCACTGTATTTAGTACCCACTGTATCATGCTACCACCCCACTTCACTTTGCTGTGCAAAGCTGTGCAAATCTCTCTCACTTGAGCACTTGAGAAAACTCGAGTTCCCTTAATGCTTTGAGCAACACTCACACAAAGATGTTAAGAGCTACCAACCGAACAACCGAACAAGCTGCAAACGTTGGCAAACGTTGGCATTTATTTGTCTTCA

Full Affymetrix probeset data:

Annotations for 1627259_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime