FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627260_at:

>probe:Drosophila_2:1627260_at:309:179; Interrogation_Position=406; Antisense; AAACAGGCATCCTATGTGGCCAAAA
>probe:Drosophila_2:1627260_at:579:171; Interrogation_Position=428; Antisense; AAAGTACTCTGGCTCAGGCGGCAGC
>probe:Drosophila_2:1627260_at:703:357; Interrogation_Position=488; Antisense; GCAAAGAGGTGCTGCTCCATCGGCT
>probe:Drosophila_2:1627260_at:724:551; Interrogation_Position=546; Antisense; GGAGAACGAGCTGACCCAACTGCAG
>probe:Drosophila_2:1627260_at:389:115; Interrogation_Position=611; Antisense; AGCAGGCCATCAACCATGTCAGTGT
>probe:Drosophila_2:1627260_at:384:61; Interrogation_Position=626; Antisense; ATGTCAGTGTCCTAACTGCCGCACT
>probe:Drosophila_2:1627260_at:215:233; Interrogation_Position=662; Antisense; AATCCGCCTCGGAGTTGGCACAAAA
>probe:Drosophila_2:1627260_at:682:577; Interrogation_Position=705; Antisense; GGCCGAGCTAGCTTCGCAAATTGAT
>probe:Drosophila_2:1627260_at:275:163; Interrogation_Position=722; Antisense; AAATTGATATGGTGGCCCAGGCCAA
>probe:Drosophila_2:1627260_at:404:551; Interrogation_Position=756; Antisense; GGAGCACGCCGAATCGCAGGCTTAT
>probe:Drosophila_2:1627260_at:445:65; Interrogation_Position=773; Antisense; AGGCTTATGCAGCTCGACTGGACTA
>probe:Drosophila_2:1627260_at:596:51; Interrogation_Position=812; Antisense; ATGCGGCGGAGAAGGCTACCTTGTC
>probe:Drosophila_2:1627260_at:288:369; Interrogation_Position=855; Antisense; GAATGCCAATGACGCGGCCTTGCAT
>probe:Drosophila_2:1627260_at:123:579; Interrogation_Position=870; Antisense; GGCCTTGCATGCCAACGTGGAGCTA

Paste this into a BLAST search page for me
AAACAGGCATCCTATGTGGCCAAAAAAAGTACTCTGGCTCAGGCGGCAGCGCAAAGAGGTGCTGCTCCATCGGCTGGAGAACGAGCTGACCCAACTGCAGAGCAGGCCATCAACCATGTCAGTGTATGTCAGTGTCCTAACTGCCGCACTAATCCGCCTCGGAGTTGGCACAAAAGGCCGAGCTAGCTTCGCAAATTGATAAATTGATATGGTGGCCCAGGCCAAGGAGCACGCCGAATCGCAGGCTTATAGGCTTATGCAGCTCGACTGGACTAATGCGGCGGAGAAGGCTACCTTGTCGAATGCCAATGACGCGGCCTTGCATGGCCTTGCATGCCAACGTGGAGCTA

Full Affymetrix probeset data:

Annotations for 1627260_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720