FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627262_at:

>probe:Drosophila_2:1627262_at:420:393; Interrogation_Position=1094; Antisense; GAAAGGTCACCAGTGCCGCGGAGAA
>probe:Drosophila_2:1627262_at:700:551; Interrogation_Position=1209; Antisense; GGAGCAGGCAACTTGTGCACTCTTT
>probe:Drosophila_2:1627262_at:560:93; Interrogation_Position=1258; Antisense; AGTTGTGGCTACATCTATCCGGAGA
>probe:Drosophila_2:1627262_at:682:653; Interrogation_Position=1295; Antisense; TCAATACGCATCATTTCACCAAGCT
>probe:Drosophila_2:1627262_at:527:91; Interrogation_Position=1321; Antisense; AGTATCTCGGGCAATTTTCCAGCTG
>probe:Drosophila_2:1627262_at:410:521; Interrogation_Position=1352; Antisense; GTGGCCGACGATTGATCATGCCCAG
>probe:Drosophila_2:1627262_at:288:725; Interrogation_Position=1381; Antisense; TTGAATGCTCTATTTCTGCCCGTTT
>probe:Drosophila_2:1627262_at:355:107; Interrogation_Position=1496; Antisense; AGAACGATCTGCTAACCTTTGCCAT
>probe:Drosophila_2:1627262_at:195:691; Interrogation_Position=1520; Antisense; TTTGGGCCAACTACTACACCGATAT
>probe:Drosophila_2:1627262_at:145:687; Interrogation_Position=1542; Antisense; TATACCCAGCACTCACAACTTGGAT
>probe:Drosophila_2:1627262_at:387:191; Interrogation_Position=1558; Antisense; AACTTGGATCACATGCAGCCGAATG
>probe:Drosophila_2:1627262_at:162:229; Interrogation_Position=1579; Antisense; AATGGAACTCAGTCCAATCCTTCGA
>probe:Drosophila_2:1627262_at:704:47; Interrogation_Position=1611; Antisense; ATCCTCGACAGTTTCGGCATTCTGG
>probe:Drosophila_2:1627262_at:184:63; Interrogation_Position=1641; Antisense; ATGTGTCCTCAACTGTTTCATCAGC

Paste this into a BLAST search page for me
GAAAGGTCACCAGTGCCGCGGAGAAGGAGCAGGCAACTTGTGCACTCTTTAGTTGTGGCTACATCTATCCGGAGATCAATACGCATCATTTCACCAAGCTAGTATCTCGGGCAATTTTCCAGCTGGTGGCCGACGATTGATCATGCCCAGTTGAATGCTCTATTTCTGCCCGTTTAGAACGATCTGCTAACCTTTGCCATTTTGGGCCAACTACTACACCGATATTATACCCAGCACTCACAACTTGGATAACTTGGATCACATGCAGCCGAATGAATGGAACTCAGTCCAATCCTTCGAATCCTCGACAGTTTCGGCATTCTGGATGTGTCCTCAACTGTTTCATCAGC

Full Affymetrix probeset data:

Annotations for 1627262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720