FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627263_at:

>probe:Drosophila_2:1627263_at:215:427; Interrogation_Position=1238; Antisense; GAGATCGTTCTCCAAGACTGCCGAG
>probe:Drosophila_2:1627263_at:644:405; Interrogation_Position=1253; Antisense; GACTGCCGAGGTACTCTGCCAGAAA
>probe:Drosophila_2:1627263_at:364:413; Interrogation_Position=1316; Antisense; GACCTTCTGGAATAATTGTACGGCC
>probe:Drosophila_2:1627263_at:557:397; Interrogation_Position=1352; Antisense; GACAACGACTTAGCGACAGCACTTT
>probe:Drosophila_2:1627263_at:589:399; Interrogation_Position=1366; Antisense; GACAGCACTTTCAGTTCTACCGACT
>probe:Drosophila_2:1627263_at:718:145; Interrogation_Position=1388; Antisense; ACTCGTCTGAGTCTTCTAGCTATGA
>probe:Drosophila_2:1627263_at:5:499; Interrogation_Position=1398; Antisense; GTCTTCTAGCTATGAATCCACCACA
>probe:Drosophila_2:1627263_at:364:459; Interrogation_Position=1435; Antisense; GATATTTCATCTTTCTCCGAATCTG
>probe:Drosophila_2:1627263_at:622:445; Interrogation_Position=1543; Antisense; GATGCAGATGCAAGATTTACCACAA
>probe:Drosophila_2:1627263_at:12:179; Interrogation_Position=1604; Antisense; AAACTCTTTCAAAGCTGTCGACGAA
>probe:Drosophila_2:1627263_at:371:45; Interrogation_Position=1643; Antisense; ATCCTCCAAATGTGTTACCCAATGC
>probe:Drosophila_2:1627263_at:58:55; Interrogation_Position=1664; Antisense; ATGCACCGAAGAAACCTCACAGCGT
>probe:Drosophila_2:1627263_at:655:257; Interrogation_Position=1681; Antisense; CACAGCGTCTTGGAGAGTTCTAACA
>probe:Drosophila_2:1627263_at:728:231; Interrogation_Position=1743; Antisense; AATGCAACTGTTGCGCGTAGAGCAG

Paste this into a BLAST search page for me
GAGATCGTTCTCCAAGACTGCCGAGGACTGCCGAGGTACTCTGCCAGAAAGACCTTCTGGAATAATTGTACGGCCGACAACGACTTAGCGACAGCACTTTGACAGCACTTTCAGTTCTACCGACTACTCGTCTGAGTCTTCTAGCTATGAGTCTTCTAGCTATGAATCCACCACAGATATTTCATCTTTCTCCGAATCTGGATGCAGATGCAAGATTTACCACAAAAACTCTTTCAAAGCTGTCGACGAAATCCTCCAAATGTGTTACCCAATGCATGCACCGAAGAAACCTCACAGCGTCACAGCGTCTTGGAGAGTTCTAACAAATGCAACTGTTGCGCGTAGAGCAG

Full Affymetrix probeset data:

Annotations for 1627263_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720