FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627267_at:

>probe:Drosophila_2:1627267_at:509:475; Interrogation_Position=1542; Antisense; GTTATGCCAATGTGCGATCCGAGTG
>probe:Drosophila_2:1627267_at:324:375; Interrogation_Position=1569; Antisense; GAACTCGGCCAACACATTTATCTGT
>probe:Drosophila_2:1627267_at:65:459; Interrogation_Position=1599; Antisense; GATTTAGGCGTCTTTACTTTAGAGA
>probe:Drosophila_2:1627267_at:71:325; Interrogation_Position=1718; Antisense; GCGATTAACGTTTGTCGATAAGCAA
>probe:Drosophila_2:1627267_at:167:473; Interrogation_Position=1750; Antisense; GTAAAACCTTTTCTAATATCACACA
>probe:Drosophila_2:1627267_at:661:19; Interrogation_Position=1794; Antisense; ATATTCGTACCATATAGTCCTGATA
>probe:Drosophila_2:1627267_at:686:89; Interrogation_Position=1826; Antisense; AGTAATCTTTATGTCCACACTCGAA
>probe:Drosophila_2:1627267_at:86:145; Interrogation_Position=1854; Antisense; ACTGCGAATGATTTTGATGCCTGAA
>probe:Drosophila_2:1627267_at:15:389; Interrogation_Position=1876; Antisense; GAAAAGCTTGCTTTCCTATCGGATT
>probe:Drosophila_2:1627267_at:633:41; Interrogation_Position=1893; Antisense; ATCGGATTATTGACTAAGCCCAGAC
>probe:Drosophila_2:1627267_at:240:209; Interrogation_Position=2014; Antisense; AAGCATTACATCATAGCCACTTGTC
>probe:Drosophila_2:1627267_at:299:313; Interrogation_Position=2029; Antisense; GCCACTTGTCTGTATGAACTTCATA
>probe:Drosophila_2:1627267_at:574:613; Interrogation_Position=2043; Antisense; TGAACTTCATATTTTGCCTGTGCAA
>probe:Drosophila_2:1627267_at:237:317; Interrogation_Position=2058; Antisense; GCCTGTGCAAAACAATCGCGAGAAT

Paste this into a BLAST search page for me
GTTATGCCAATGTGCGATCCGAGTGGAACTCGGCCAACACATTTATCTGTGATTTAGGCGTCTTTACTTTAGAGAGCGATTAACGTTTGTCGATAAGCAAGTAAAACCTTTTCTAATATCACACAATATTCGTACCATATAGTCCTGATAAGTAATCTTTATGTCCACACTCGAAACTGCGAATGATTTTGATGCCTGAAGAAAAGCTTGCTTTCCTATCGGATTATCGGATTATTGACTAAGCCCAGACAAGCATTACATCATAGCCACTTGTCGCCACTTGTCTGTATGAACTTCATATGAACTTCATATTTTGCCTGTGCAAGCCTGTGCAAAACAATCGCGAGAAT

Full Affymetrix probeset data:

Annotations for 1627267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720