Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627268_at:

>probe:Drosophila_2:1627268_at:465:435; Interrogation_Position=308; Antisense; GAGGTGCAAATCTCCAGGATCGCAT
>probe:Drosophila_2:1627268_at:214:451; Interrogation_Position=325; Antisense; GATCGCATCAGTGTGGGTCCTTATG
>probe:Drosophila_2:1627268_at:362:677; Interrogation_Position=362; Antisense; TAGAGGCATCGCATGCACCGAATGT
>probe:Drosophila_2:1627268_at:264:117; Interrogation_Position=391; Antisense; AGCTTTGAAAGCAATTCCCACCCGT
>probe:Drosophila_2:1627268_at:703:553; Interrogation_Position=478; Antisense; GGAGCTGCAAGTGGCGCCTTTTTCG
>probe:Drosophila_2:1627268_at:170:303; Interrogation_Position=493; Antisense; GCCTTTTTCGGCAGTTCTAGTGTAG
>probe:Drosophila_2:1627268_at:528:333; Interrogation_Position=520; Antisense; GCTGGTATTCCCTTCGATGTGTATG
>probe:Drosophila_2:1627268_at:113:467; Interrogation_Position=565; Antisense; GTTGGACATGGCCATTATTCACCGC
>probe:Drosophila_2:1627268_at:197:365; Interrogation_Position=592; Antisense; GAATATGCGTATCCGTATCCTCTGG
>probe:Drosophila_2:1627268_at:706:483; Interrogation_Position=606; Antisense; GTATCCTCTGGATCACCACGAGATA
>probe:Drosophila_2:1627268_at:427:579; Interrogation_Position=680; Antisense; TGGCCAAAAGCTTTCTCATCCCGTT
>probe:Drosophila_2:1627268_at:555:85; Interrogation_Position=709; Antisense; AGTGCTGCAGTTCTTGGTATCGCCG
>probe:Drosophila_2:1627268_at:23:513; Interrogation_Position=781; Antisense; GGGCTGGGAACCATCGTTGGCAAAC
>probe:Drosophila_2:1627268_at:410:661; Interrogation_Position=807; Antisense; TAAACGACGAGCAGCAGGCCGAAAT

Paste this into a BLAST search page for me
GAGGTGCAAATCTCCAGGATCGCATGATCGCATCAGTGTGGGTCCTTATGTAGAGGCATCGCATGCACCGAATGTAGCTTTGAAAGCAATTCCCACCCGTGGAGCTGCAAGTGGCGCCTTTTTCGGCCTTTTTCGGCAGTTCTAGTGTAGGCTGGTATTCCCTTCGATGTGTATGGTTGGACATGGCCATTATTCACCGCGAATATGCGTATCCGTATCCTCTGGGTATCCTCTGGATCACCACGAGATATGGCCAAAAGCTTTCTCATCCCGTTAGTGCTGCAGTTCTTGGTATCGCCGGGGCTGGGAACCATCGTTGGCAAACTAAACGACGAGCAGCAGGCCGAAAT

Full Affymetrix probeset data:

Annotations for 1627268_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime