FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627270_at:

>probe:Drosophila_2:1627270_at:462:171; Interrogation_Position=1335; Antisense; AAAGAGAGTGCAGTGGCGTAGCCAA
>probe:Drosophila_2:1627270_at:83:537; Interrogation_Position=1371; Antisense; GGTCGGGTCACAACAAAGAGTCACT
>probe:Drosophila_2:1627270_at:222:251; Interrogation_Position=1384; Antisense; CAAAGAGTCACTTAACCTAGTTATT
>probe:Drosophila_2:1627270_at:273:583; Interrogation_Position=1439; Antisense; TGGCGTACAGAGTTGTTGGTGCAAA
>probe:Drosophila_2:1627270_at:275:5; Interrogation_Position=1468; Antisense; ATTGGGCATAATCTACATAATCTAT
>probe:Drosophila_2:1627270_at:156:249; Interrogation_Position=1501; Antisense; CAATTTCGGTGTACATATGCAAACT
>probe:Drosophila_2:1627270_at:637:601; Interrogation_Position=1586; Antisense; TGTATTTATGTATGCCAGGCTTCCA
>probe:Drosophila_2:1627270_at:51:485; Interrogation_Position=1595; Antisense; GTATGCCAGGCTTCCAAATAGAATA
>probe:Drosophila_2:1627270_at:555:419; Interrogation_Position=1622; Antisense; GAGCATAGAACCTATCCCAAAACCC
>probe:Drosophila_2:1627270_at:462:727; Interrogation_Position=1682; Antisense; TTGTACCTGCGGTTTCGCGACAAGA
>probe:Drosophila_2:1627270_at:109:423; Interrogation_Position=1715; Antisense; GAGAATTGCAACTGCCAATTGCATT
>probe:Drosophila_2:1627270_at:495:483; Interrogation_Position=1740; Antisense; GTATAACAAAGACCACATCAGCAAC
>probe:Drosophila_2:1627270_at:388:359; Interrogation_Position=1760; Antisense; GCAACAACCCACAACAAGACAAAAC
>probe:Drosophila_2:1627270_at:715:695; Interrogation_Position=1829; Antisense; TTTACCCTTCATTTTATAATTGCAT

Paste this into a BLAST search page for me
AAAGAGAGTGCAGTGGCGTAGCCAAGGTCGGGTCACAACAAAGAGTCACTCAAAGAGTCACTTAACCTAGTTATTTGGCGTACAGAGTTGTTGGTGCAAAATTGGGCATAATCTACATAATCTATCAATTTCGGTGTACATATGCAAACTTGTATTTATGTATGCCAGGCTTCCAGTATGCCAGGCTTCCAAATAGAATAGAGCATAGAACCTATCCCAAAACCCTTGTACCTGCGGTTTCGCGACAAGAGAGAATTGCAACTGCCAATTGCATTGTATAACAAAGACCACATCAGCAACGCAACAACCCACAACAAGACAAAACTTTACCCTTCATTTTATAATTGCAT

Full Affymetrix probeset data:

Annotations for 1627270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720