FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627271_at:

>probe:Drosophila_2:1627271_at:18:495; Interrogation_Position=109; Antisense; GTCAAGGTCAACTCACCGAAGGGAT
>probe:Drosophila_2:1627271_at:553:45; Interrogation_Position=13; Antisense; ATCGCCATGGCGCAAAACTCAAAGT
>probe:Drosophila_2:1627271_at:45:547; Interrogation_Position=150; Antisense; GGATGAGCCAGGCATTTCCCTATTC
>probe:Drosophila_2:1627271_at:440:689; Interrogation_Position=170; Antisense; TATTCGCTTTTCACGGCAAGGTCAA
>probe:Drosophila_2:1627271_at:21:301; Interrogation_Position=231; Antisense; CGCCGATGTGGTCAGTTCACGCAAT
>probe:Drosophila_2:1627271_at:689:711; Interrogation_Position=246; Antisense; TTCACGCAATGGACGCTGGACTTAT
>probe:Drosophila_2:1627271_at:430:557; Interrogation_Position=263; Antisense; GGACTTATCGCAACCGGAACCATCA
>probe:Drosophila_2:1627271_at:255:563; Interrogation_Position=278; Antisense; GGAACCATCAGCTTAGACCCGGAGA
>probe:Drosophila_2:1627271_at:102:105; Interrogation_Position=292; Antisense; AGACCCGGAGATGTTCTGTACTATT
>probe:Drosophila_2:1627271_at:493:489; Interrogation_Position=309; Antisense; GTACTATTGGACAACGGCGCGTTAC
>probe:Drosophila_2:1627271_at:467:575; Interrogation_Position=324; Antisense; GGCGCGTTACCATGGAGTCGACTAT
>probe:Drosophila_2:1627271_at:120:111; Interrogation_Position=394; Antisense; AGAATCGATGTCAACGGCTCCAACG
>probe:Drosophila_2:1627271_at:223:161; Interrogation_Position=40; Antisense; ACAATCTATCTGTTCCTAGTCGCAA
>probe:Drosophila_2:1627271_at:376:679; Interrogation_Position=56; Antisense; TAGTCGCAATTTCCGTGGGCTCCAG

Paste this into a BLAST search page for me
GTCAAGGTCAACTCACCGAAGGGATATCGCCATGGCGCAAAACTCAAAGTGGATGAGCCAGGCATTTCCCTATTCTATTCGCTTTTCACGGCAAGGTCAACGCCGATGTGGTCAGTTCACGCAATTTCACGCAATGGACGCTGGACTTATGGACTTATCGCAACCGGAACCATCAGGAACCATCAGCTTAGACCCGGAGAAGACCCGGAGATGTTCTGTACTATTGTACTATTGGACAACGGCGCGTTACGGCGCGTTACCATGGAGTCGACTATAGAATCGATGTCAACGGCTCCAACGACAATCTATCTGTTCCTAGTCGCAATAGTCGCAATTTCCGTGGGCTCCAG

Full Affymetrix probeset data:

Annotations for 1627271_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720