Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627272_at:

>probe:Drosophila_2:1627272_at:7:659; Interrogation_Position=111; Antisense; TAAGATAGCCGAGTGCTGCCTGCCA
>probe:Drosophila_2:1627272_at:224:59; Interrogation_Position=145; Antisense; ATGTTCGAGGCCTTTTATCCCCGTG
>probe:Drosophila_2:1627272_at:219:435; Interrogation_Position=175; Antisense; GAGGGAATCCCCAATAGCGCATCGC
>probe:Drosophila_2:1627272_at:120:493; Interrogation_Position=19; Antisense; GTAACTGCGCTATTGCTCAAGGCTT
>probe:Drosophila_2:1627272_at:340:157; Interrogation_Position=207; Antisense; ACACGGACATGGCAGCTTCTTCAAG
>probe:Drosophila_2:1627272_at:644:67; Interrogation_Position=215; Antisense; ATGGCAGCTTCTTCAAGCACCGGAA
>probe:Drosophila_2:1627272_at:300:563; Interrogation_Position=236; Antisense; GGAACCCAGCGCTAGTGGACACCAA
>probe:Drosophila_2:1627272_at:531:585; Interrogation_Position=251; Antisense; TGGACACCAAGAACGCGGCGGCCTA
>probe:Drosophila_2:1627272_at:316:277; Interrogation_Position=273; Antisense; CTATGGCTATAGGTTCGACGGCAAG
>probe:Drosophila_2:1627272_at:238:637; Interrogation_Position=287; Antisense; TCGACGGCAAGAGGCGTTTCAACTT
>probe:Drosophila_2:1627272_at:674:225; Interrogation_Position=37; Antisense; AAGGCTTTGTTTGTGCTCGGGCTGA
>probe:Drosophila_2:1627272_at:354:329; Interrogation_Position=57; Antisense; GCTGACCGTACTTTCGGGACCAGGA
>probe:Drosophila_2:1627272_at:523:413; Interrogation_Position=74; Antisense; GACCAGGAAGAGTGGCTGCCTACGA
>probe:Drosophila_2:1627272_at:424:627; Interrogation_Position=90; Antisense; TGCCTACGATCCCAATGATCCTAAG

Paste this into a BLAST search page for me
TAAGATAGCCGAGTGCTGCCTGCCAATGTTCGAGGCCTTTTATCCCCGTGGAGGGAATCCCCAATAGCGCATCGCGTAACTGCGCTATTGCTCAAGGCTTACACGGACATGGCAGCTTCTTCAAGATGGCAGCTTCTTCAAGCACCGGAAGGAACCCAGCGCTAGTGGACACCAATGGACACCAAGAACGCGGCGGCCTACTATGGCTATAGGTTCGACGGCAAGTCGACGGCAAGAGGCGTTTCAACTTAAGGCTTTGTTTGTGCTCGGGCTGAGCTGACCGTACTTTCGGGACCAGGAGACCAGGAAGAGTGGCTGCCTACGATGCCTACGATCCCAATGATCCTAAG

Full Affymetrix probeset data:

Annotations for 1627272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime