FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627273_at:

>probe:Drosophila_2:1627273_at:624:23; Interrogation_Position=1015; Antisense; ATATCCTTCGTCTTCTCCATGAGGA
>probe:Drosophila_2:1627273_at:209:321; Interrogation_Position=1068; Antisense; GCGCCGTCGCGTATTTTAGACCATA
>probe:Drosophila_2:1627273_at:94:67; Interrogation_Position=1104; Antisense; ATGGCTTTAGGAGCAGCACCCACAA
>probe:Drosophila_2:1627273_at:56:399; Interrogation_Position=1158; Antisense; GACACTAAAGCAGCGCATTCCACAA
>probe:Drosophila_2:1627273_at:700:573; Interrogation_Position=668; Antisense; GGCGTCGTGCCATTAACTACGTAAC
>probe:Drosophila_2:1627273_at:185:495; Interrogation_Position=736; Antisense; GTCAAGCGCTGTGGCCAGTCGGCTA
>probe:Drosophila_2:1627273_at:411:571; Interrogation_Position=756; Antisense; GGCTATCGCCAAGCATCTTCTGTTG
>probe:Drosophila_2:1627273_at:504:37; Interrogation_Position=770; Antisense; ATCTTCTGTTGGTGCTGCATCTGAT
>probe:Drosophila_2:1627273_at:147:41; Interrogation_Position=788; Antisense; ATCTGATCGCCCTGGTGGTGGTTGT
>probe:Drosophila_2:1627273_at:259:403; Interrogation_Position=833; Antisense; GACTTGGATGGCTCTGCGGCGACAT
>probe:Drosophila_2:1627273_at:458:315; Interrogation_Position=866; Antisense; GCCTAGGACGCGTCAAGTACCAGTC
>probe:Drosophila_2:1627273_at:659:581; Interrogation_Position=916; Antisense; TGGCGGCTGGCCATTGCCAAGAGTA
>probe:Drosophila_2:1627273_at:426:99; Interrogation_Position=935; Antisense; AGAGTAACGACACCTTTCTCTTTCT
>probe:Drosophila_2:1627273_at:119:645; Interrogation_Position=953; Antisense; TCTTTCTCATCGTGGTGCTGGTGAC

Paste this into a BLAST search page for me
ATATCCTTCGTCTTCTCCATGAGGAGCGCCGTCGCGTATTTTAGACCATAATGGCTTTAGGAGCAGCACCCACAAGACACTAAAGCAGCGCATTCCACAAGGCGTCGTGCCATTAACTACGTAACGTCAAGCGCTGTGGCCAGTCGGCTAGGCTATCGCCAAGCATCTTCTGTTGATCTTCTGTTGGTGCTGCATCTGATATCTGATCGCCCTGGTGGTGGTTGTGACTTGGATGGCTCTGCGGCGACATGCCTAGGACGCGTCAAGTACCAGTCTGGCGGCTGGCCATTGCCAAGAGTAAGAGTAACGACACCTTTCTCTTTCTTCTTTCTCATCGTGGTGCTGGTGAC

Full Affymetrix probeset data:

Annotations for 1627273_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720