Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627274_at:

>probe:Drosophila_2:1627274_at:337:357; Interrogation_Position=2211; Antisense; GCACAAGCAGCGAAAGCCTGCACTT
>probe:Drosophila_2:1627274_at:492:275; Interrogation_Position=2233; Antisense; CTTCGCCAAGCGGTGATTGGGAAAA
>probe:Drosophila_2:1627274_at:168:385; Interrogation_Position=2347; Antisense; GAACTTGAACTCTACGACGGCGGCA
>probe:Drosophila_2:1627274_at:372:279; Interrogation_Position=2358; Antisense; CTACGACGGCGGCAGCTGGAAAAAT
>probe:Drosophila_2:1627274_at:366:119; Interrogation_Position=2371; Antisense; AGCTGGAAAAATGTTTGCCCCGATC
>probe:Drosophila_2:1627274_at:529:527; Interrogation_Position=2399; Antisense; GGGACACCGACTCAGTCACTCAGTC
>probe:Drosophila_2:1627274_at:639:231; Interrogation_Position=2430; Antisense; AATGCGCGGCATTTCCGTTCGGAAA
>probe:Drosophila_2:1627274_at:286:441; Interrogation_Position=2463; Antisense; GATGCTGTCGAGAAGGAAGGCCCTC
>probe:Drosophila_2:1627274_at:377:371; Interrogation_Position=2478; Antisense; GAAGGCCCTCGATCGATTCGATGCT
>probe:Drosophila_2:1627274_at:653:483; Interrogation_Position=2530; Antisense; GTAGTGATCATGTTTGTAGCATCTA
>probe:Drosophila_2:1627274_at:232:643; Interrogation_Position=2577; Antisense; TCATTAAGTAATGCGTCGTCTTTGG
>probe:Drosophila_2:1627274_at:353:637; Interrogation_Position=2592; Antisense; TCGTCTTTGGCTTCTTGGTTTATGA
>probe:Drosophila_2:1627274_at:509:341; Interrogation_Position=2601; Antisense; GCTTCTTGGTTTATGAACACGGCAA
>probe:Drosophila_2:1627274_at:545:241; Interrogation_Position=2719; Antisense; AATACTGCTTTCTTTGACGTTGTAA

Paste this into a BLAST search page for me
GCACAAGCAGCGAAAGCCTGCACTTCTTCGCCAAGCGGTGATTGGGAAAAGAACTTGAACTCTACGACGGCGGCACTACGACGGCGGCAGCTGGAAAAATAGCTGGAAAAATGTTTGCCCCGATCGGGACACCGACTCAGTCACTCAGTCAATGCGCGGCATTTCCGTTCGGAAAGATGCTGTCGAGAAGGAAGGCCCTCGAAGGCCCTCGATCGATTCGATGCTGTAGTGATCATGTTTGTAGCATCTATCATTAAGTAATGCGTCGTCTTTGGTCGTCTTTGGCTTCTTGGTTTATGAGCTTCTTGGTTTATGAACACGGCAAAATACTGCTTTCTTTGACGTTGTAA

Full Affymetrix probeset data:

Annotations for 1627274_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime