Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627275_at:

>probe:Drosophila_2:1627275_at:194:475; Interrogation_Position=3077; Antisense; GTTAGCGGGCCCAACGACATGATAG
>probe:Drosophila_2:1627275_at:278:433; Interrogation_Position=3101; Antisense; GAGTGCAGCTCGATTATAGCCAAAA
>probe:Drosophila_2:1627275_at:664:209; Interrogation_Position=3165; Antisense; AAGCAGCCGGACAGCCATGTTCACA
>probe:Drosophila_2:1627275_at:237:155; Interrogation_Position=3187; Antisense; ACAGCTCGTTCGCACAGGATCAGAA
>probe:Drosophila_2:1627275_at:718:383; Interrogation_Position=3215; Antisense; GAAAGCGTGAATTCCGAAACTTCCA
>probe:Drosophila_2:1627275_at:172:629; Interrogation_Position=3236; Antisense; TCCACGATGGCTACACACGAATTTA
>probe:Drosophila_2:1627275_at:130:359; Interrogation_Position=3326; Antisense; GCAAACTCCGAATTAAGCACTGAAA
>probe:Drosophila_2:1627275_at:541:185; Interrogation_Position=3349; Antisense; AACAGAAGTGTTGAAGCCCACCGAT
>probe:Drosophila_2:1627275_at:263:321; Interrogation_Position=3364; Antisense; GCCCACCGATGAGACTGAAGCGCAT
>probe:Drosophila_2:1627275_at:612:345; Interrogation_Position=3385; Antisense; GCATATGATCCATGACGCCCTAAAA
>probe:Drosophila_2:1627275_at:72:105; Interrogation_Position=3429; Antisense; AGACTCTGGACTTACAGTTCTTGTC
>probe:Drosophila_2:1627275_at:728:543; Interrogation_Position=3473; Antisense; GGATAACAGACCCAGGAGTCCCCAG
>probe:Drosophila_2:1627275_at:475:431; Interrogation_Position=3488; Antisense; GAGTCCCCAGGAGATGTCATAGAAA
>probe:Drosophila_2:1627275_at:249:193; Interrogation_Position=3511; Antisense; AACTAGTGATCTCAAACAGGTCCCC

Paste this into a BLAST search page for me
GTTAGCGGGCCCAACGACATGATAGGAGTGCAGCTCGATTATAGCCAAAAAAGCAGCCGGACAGCCATGTTCACAACAGCTCGTTCGCACAGGATCAGAAGAAAGCGTGAATTCCGAAACTTCCATCCACGATGGCTACACACGAATTTAGCAAACTCCGAATTAAGCACTGAAAAACAGAAGTGTTGAAGCCCACCGATGCCCACCGATGAGACTGAAGCGCATGCATATGATCCATGACGCCCTAAAAAGACTCTGGACTTACAGTTCTTGTCGGATAACAGACCCAGGAGTCCCCAGGAGTCCCCAGGAGATGTCATAGAAAAACTAGTGATCTCAAACAGGTCCCC

Full Affymetrix probeset data:

Annotations for 1627275_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime