Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627281_at:

>probe:Drosophila_2:1627281_at:603:541; Interrogation_Position=1076; Antisense; GGATCAATCCGCACTTGGAGCAAGT
>probe:Drosophila_2:1627281_at:627:421; Interrogation_Position=1093; Antisense; GAGCAAGTGCTTAGCGTGCCTGGAA
>probe:Drosophila_2:1627281_at:649:395; Interrogation_Position=1115; Antisense; GAAATATGCTTCCTGCCATGTCATA
>probe:Drosophila_2:1627281_at:425:439; Interrogation_Position=610; Antisense; GAGGCCTTTAACTACAGCAGCGGAG
>probe:Drosophila_2:1627281_at:224:645; Interrogation_Position=653; Antisense; TCTTCTTGGATTCGCCTTTTGAGTT
>probe:Drosophila_2:1627281_at:85:467; Interrogation_Position=675; Antisense; GTTGAGGGCCAACATCCAGACCATT
>probe:Drosophila_2:1627281_at:67:673; Interrogation_Position=704; Antisense; TACCCATTCCGGACAAGACTTTCGA
>probe:Drosophila_2:1627281_at:576:467; Interrogation_Position=778; Antisense; GTTGATATTCAGACCATCCAGCAGA
>probe:Drosophila_2:1627281_at:429:457; Interrogation_Position=808; Antisense; GATTTGCCCGTTGTCGAAAGTTCCA
>probe:Drosophila_2:1627281_at:669:167; Interrogation_Position=860; Antisense; AAATGGGCTCGAACTACCAGCTGCC
>probe:Drosophila_2:1627281_at:688:307; Interrogation_Position=887; Antisense; CCAGTTTAATGTGTGCCGGCGGTGA
>probe:Drosophila_2:1627281_at:198:141; Interrogation_Position=918; Antisense; ACGGGATGTCTGTTCTCTATTCGGA
>probe:Drosophila_2:1627281_at:73:557; Interrogation_Position=966; Antisense; GGACGATGATCCCAATCGCTACGAG
>probe:Drosophila_2:1627281_at:476:569; Interrogation_Position=997; Antisense; GGCATCGTAAGCTTCGGCGTTGGAT

Paste this into a BLAST search page for me
GGATCAATCCGCACTTGGAGCAAGTGAGCAAGTGCTTAGCGTGCCTGGAAGAAATATGCTTCCTGCCATGTCATAGAGGCCTTTAACTACAGCAGCGGAGTCTTCTTGGATTCGCCTTTTGAGTTGTTGAGGGCCAACATCCAGACCATTTACCCATTCCGGACAAGACTTTCGAGTTGATATTCAGACCATCCAGCAGAGATTTGCCCGTTGTCGAAAGTTCCAAAATGGGCTCGAACTACCAGCTGCCCCAGTTTAATGTGTGCCGGCGGTGAACGGGATGTCTGTTCTCTATTCGGAGGACGATGATCCCAATCGCTACGAGGGCATCGTAAGCTTCGGCGTTGGAT

Full Affymetrix probeset data:

Annotations for 1627281_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime