FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627282_at:

>probe:Drosophila_2:1627282_at:549:601; Interrogation_Position=1881; Antisense; TGTTAAGGCCTTTCACGAGGAGCTA
>probe:Drosophila_2:1627282_at:204:463; Interrogation_Position=1948; Antisense; GATTCTCGTTTGAATTTCGGCCAAG
>probe:Drosophila_2:1627282_at:34:579; Interrogation_Position=1966; Antisense; GGCCAAGAGTTTTACGATCCCGAGA
>probe:Drosophila_2:1627282_at:703:45; Interrogation_Position=1982; Antisense; ATCCCGAGAATATCCCCTTGATGAA
>probe:Drosophila_2:1627282_at:450:181; Interrogation_Position=2047; Antisense; AAAAGATATGTATTGCCCACCCTCC
>probe:Drosophila_2:1627282_at:510:597; Interrogation_Position=2085; Antisense; TGTGCCCTACCTCATCGAATGGATA
>probe:Drosophila_2:1627282_at:306:607; Interrogation_Position=2198; Antisense; TGATGCACACCAACCTTGCGAAGAT
>probe:Drosophila_2:1627282_at:580:321; Interrogation_Position=2227; Antisense; GCCCTGCCGATTGGAGACAACTTTA
>probe:Drosophila_2:1627282_at:301:217; Interrogation_Position=2284; Antisense; AAGTTCAGGGAACGCCATACCAATA
>probe:Drosophila_2:1627282_at:107:241; Interrogation_Position=2305; Antisense; AATAAGTTCCTTGAAGCCATCATGG
>probe:Drosophila_2:1627282_at:82:427; Interrogation_Position=2335; Antisense; GAGAGGGTCTTTTATTCGGCCATGA
>probe:Drosophila_2:1627282_at:633:53; Interrogation_Position=2356; Antisense; ATGAAACCCCATCTCTGTAATCTAG
>probe:Drosophila_2:1627282_at:612:605; Interrogation_Position=2385; Antisense; TGAGGAGACCTTTTTGGCCTACTTG
>probe:Drosophila_2:1627282_at:46:305; Interrogation_Position=2427; Antisense; CCTGGGCTTCACTGTTAATACCGTA

Paste this into a BLAST search page for me
TGTTAAGGCCTTTCACGAGGAGCTAGATTCTCGTTTGAATTTCGGCCAAGGGCCAAGAGTTTTACGATCCCGAGAATCCCGAGAATATCCCCTTGATGAAAAAAGATATGTATTGCCCACCCTCCTGTGCCCTACCTCATCGAATGGATATGATGCACACCAACCTTGCGAAGATGCCCTGCCGATTGGAGACAACTTTAAAGTTCAGGGAACGCCATACCAATAAATAAGTTCCTTGAAGCCATCATGGGAGAGGGTCTTTTATTCGGCCATGAATGAAACCCCATCTCTGTAATCTAGTGAGGAGACCTTTTTGGCCTACTTGCCTGGGCTTCACTGTTAATACCGTA

Full Affymetrix probeset data:

Annotations for 1627282_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720