FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627284_at:

>probe:Drosophila_2:1627284_at:207:405; Interrogation_Position=1369; Antisense; GACTGCCATGAGTGGCGATCGCATT
>probe:Drosophila_2:1627284_at:688:43; Interrogation_Position=1386; Antisense; ATCGCATTGCGACAGTACTCTTCTA
>probe:Drosophila_2:1627284_at:38:91; Interrogation_Position=1399; Antisense; AGTACTCTTCTACCTGACGGATGTA
>probe:Drosophila_2:1627284_at:162:415; Interrogation_Position=1434; Antisense; GAGCCACCGTGTTTCCAAACATTAG
>probe:Drosophila_2:1627284_at:462:197; Interrogation_Position=1476; Antisense; AACGCGGATCTGTGGTAATGTGGTA
>probe:Drosophila_2:1627284_at:595:537; Interrogation_Position=1497; Antisense; GGTACAATCTCAAGGACAACGGTCA
>probe:Drosophila_2:1627284_at:61:723; Interrogation_Position=1524; Antisense; TTGATACTCAAACTCTTCATGCCGC
>probe:Drosophila_2:1627284_at:723:341; Interrogation_Position=1547; Antisense; GCTTGCCCCGTTATAGTGGGTTCCA
>probe:Drosophila_2:1627284_at:268:459; Interrogation_Position=1609; Antisense; GATATTCAGCAGACCTTGCCTCAAA
>probe:Drosophila_2:1627284_at:380:323; Interrogation_Position=1636; Antisense; GCGAATGTGATTCTCAGCGAAACTG
>probe:Drosophila_2:1627284_at:477:493; Interrogation_Position=1729; Antisense; GTCAATTAAACATTCCCAGCGATAA
>probe:Drosophila_2:1627284_at:602:239; Interrogation_Position=1765; Antisense; AATCAAGTCGCGACATTCCGAAGAG
>probe:Drosophila_2:1627284_at:506:365; Interrogation_Position=1790; Antisense; GAATAGGTGTTTTCCCCAGAGTCGT
>probe:Drosophila_2:1627284_at:5:697; Interrogation_Position=1800; Antisense; TTTCCCCAGAGTCGTTCATCAAAAT

Paste this into a BLAST search page for me
GACTGCCATGAGTGGCGATCGCATTATCGCATTGCGACAGTACTCTTCTAAGTACTCTTCTACCTGACGGATGTAGAGCCACCGTGTTTCCAAACATTAGAACGCGGATCTGTGGTAATGTGGTAGGTACAATCTCAAGGACAACGGTCATTGATACTCAAACTCTTCATGCCGCGCTTGCCCCGTTATAGTGGGTTCCAGATATTCAGCAGACCTTGCCTCAAAGCGAATGTGATTCTCAGCGAAACTGGTCAATTAAACATTCCCAGCGATAAAATCAAGTCGCGACATTCCGAAGAGGAATAGGTGTTTTCCCCAGAGTCGTTTTCCCCAGAGTCGTTCATCAAAAT

Full Affymetrix probeset data:

Annotations for 1627284_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720