FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627285_at:

>probe:Drosophila_2:1627285_at:164:383; Interrogation_Position=2277; Antisense; GAACAGGGAGGCCACGCCCACATGT
>probe:Drosophila_2:1627285_at:730:127; Interrogation_Position=2311; Antisense; ACGCCCGACATTCAGCTGATCAAGC
>probe:Drosophila_2:1627285_at:413:83; Interrogation_Position=2340; Antisense; AGTGAAGACGGAACTGTCGCCGGCA
>probe:Drosophila_2:1627285_at:232:599; Interrogation_Position=2354; Antisense; TGTCGCCGGCAGAGAACCTGAGTAA
>probe:Drosophila_2:1627285_at:312:3; Interrogation_Position=2454; Antisense; ATTGGACATGGAAACGGACTCGAAC
>probe:Drosophila_2:1627285_at:262:439; Interrogation_Position=2498; Antisense; GAGGCGACAACAACAATGGGCTAGC
>probe:Drosophila_2:1627285_at:10:677; Interrogation_Position=2519; Antisense; TAGCATTGGCGCTGGGCAAGCACAA
>probe:Drosophila_2:1627285_at:134:113; Interrogation_Position=2537; Antisense; AGCACAAGCTGCTGAGCGCGATCAA
>probe:Drosophila_2:1627285_at:557:73; Interrogation_Position=2563; Antisense; AGGAACATAGAGCAGGATCACCCAG
>probe:Drosophila_2:1627285_at:550:453; Interrogation_Position=2578; Antisense; GATCACCCAGATCATGAGCATCAGG
>probe:Drosophila_2:1627285_at:559:453; Interrogation_Position=2623; Antisense; GATCACGGCGGGAACAACTGCAACA
>probe:Drosophila_2:1627285_at:139:587; Interrogation_Position=2684; Antisense; TGGACCTGAGCACCATCAAGAACAT
>probe:Drosophila_2:1627285_at:272:289; Interrogation_Position=2714; Antisense; CGGCGGAGATCCTTTGCGGACTGAA
>probe:Drosophila_2:1627285_at:291:381; Interrogation_Position=2797; Antisense; GAACGGGAAGCCTGTCGCAGTCTTA

Paste this into a BLAST search page for me
GAACAGGGAGGCCACGCCCACATGTACGCCCGACATTCAGCTGATCAAGCAGTGAAGACGGAACTGTCGCCGGCATGTCGCCGGCAGAGAACCTGAGTAAATTGGACATGGAAACGGACTCGAACGAGGCGACAACAACAATGGGCTAGCTAGCATTGGCGCTGGGCAAGCACAAAGCACAAGCTGCTGAGCGCGATCAAAGGAACATAGAGCAGGATCACCCAGGATCACCCAGATCATGAGCATCAGGGATCACGGCGGGAACAACTGCAACATGGACCTGAGCACCATCAAGAACATCGGCGGAGATCCTTTGCGGACTGAAGAACGGGAAGCCTGTCGCAGTCTTA

Full Affymetrix probeset data:

Annotations for 1627285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720