FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627286_at:

>probe:Drosophila_2:1627286_at:402:707; Interrogation_Position=1475; Antisense; TTAAACGTCCCAATATCACCAGTCG
>probe:Drosophila_2:1627286_at:689:501; Interrogation_Position=1496; Antisense; GTCGCCAAAGGCATAATCTCCGTTT
>probe:Drosophila_2:1627286_at:473:601; Interrogation_Position=1509; Antisense; TAATCTCCGTTTGCGGGAGCGTTTG
>probe:Drosophila_2:1627286_at:567:415; Interrogation_Position=1601; Antisense; GAGCCCGCGGTGGAATGCAATCATC
>probe:Drosophila_2:1627286_at:653:453; Interrogation_Position=1666; Antisense; GATCATCGTTCTGTGGAGCGCGTGA
>probe:Drosophila_2:1627286_at:179:419; Interrogation_Position=1689; Antisense; GAGCTCGCGAATCAAGCGTTTGCCA
>probe:Drosophila_2:1627286_at:241:169; Interrogation_Position=1713; Antisense; AAAGGGAAGACGCTATCGCCAGCCC
>probe:Drosophila_2:1627286_at:599:29; Interrogation_Position=1802; Antisense; ATAAATCGATGTCTCCAAGTCGCCC
>probe:Drosophila_2:1627286_at:460:273; Interrogation_Position=1833; Antisense; CATTCCACGAGTCCGTCGAAGATTT
>probe:Drosophila_2:1627286_at:488:95; Interrogation_Position=1852; Antisense; AGATTTCGATCCGTTCTGGTGGACA
>probe:Drosophila_2:1627286_at:365:217; Interrogation_Position=1887; Antisense; AAGTATCGCCTTAATGGGTCAGCCG
>probe:Drosophila_2:1627286_at:403:65; Interrogation_Position=1900; Antisense; ATGGGTCAGCCGGTGCAATCAAAGC
>probe:Drosophila_2:1627286_at:251:663; Interrogation_Position=1941; Antisense; TAAACGTCATCTTACCATTGCCTTT
>probe:Drosophila_2:1627286_at:69:233; Interrogation_Position=1990; Antisense; AATGCAGCCGTTCAGCCCTGGAAGT

Paste this into a BLAST search page for me
TTAAACGTCCCAATATCACCAGTCGGTCGCCAAAGGCATAATCTCCGTTTTAATCTCCGTTTGCGGGAGCGTTTGGAGCCCGCGGTGGAATGCAATCATCGATCATCGTTCTGTGGAGCGCGTGAGAGCTCGCGAATCAAGCGTTTGCCAAAAGGGAAGACGCTATCGCCAGCCCATAAATCGATGTCTCCAAGTCGCCCCATTCCACGAGTCCGTCGAAGATTTAGATTTCGATCCGTTCTGGTGGACAAAGTATCGCCTTAATGGGTCAGCCGATGGGTCAGCCGGTGCAATCAAAGCTAAACGTCATCTTACCATTGCCTTTAATGCAGCCGTTCAGCCCTGGAAGT

Full Affymetrix probeset data:

Annotations for 1627286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720