FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627287_at:

>probe:Drosophila_2:1627287_at:492:643; Interrogation_Position=2015; Antisense; TCTCACGGGCGCTGAAAATGTCCTG
>probe:Drosophila_2:1627287_at:414:613; Interrogation_Position=2027; Antisense; TGAAAATGTCCTGCGCTCCAGCTAT
>probe:Drosophila_2:1627287_at:432:323; Interrogation_Position=2039; Antisense; GCGCTCCAGCTATTGCAAGGATTAA
>probe:Drosophila_2:1627287_at:91:711; Interrogation_Position=2234; Antisense; TTAAGAACTCAGCTCACACTTTCTC
>probe:Drosophila_2:1627287_at:56:157; Interrogation_Position=2249; Antisense; ACACTTTCTCAGCACCCAATATGAT
>probe:Drosophila_2:1627287_at:227:173; Interrogation_Position=2291; Antisense; AAAGCAGTGCAGGTTTGCGTCACCG
>probe:Drosophila_2:1627287_at:1:329; Interrogation_Position=2307; Antisense; GCGTCACCGCTAAGTTGTTTGCACA
>probe:Drosophila_2:1627287_at:549:479; Interrogation_Position=2323; Antisense; GTTTGCACAACCAGAAGTGGCACAG
>probe:Drosophila_2:1627287_at:118:155; Interrogation_Position=2344; Antisense; ACAGATGCAGATGCGTGTCTGCGCT
>probe:Drosophila_2:1627287_at:373:291; Interrogation_Position=2357; Antisense; CGTGTCTGCGCTGTGGGAACAGATC
>probe:Drosophila_2:1627287_at:480:265; Interrogation_Position=2378; Antisense; GATCGAAAAAGTGTTCCCAGTTTGA
>probe:Drosophila_2:1627287_at:651:477; Interrogation_Position=2397; Antisense; GTTTGACTTTTATAGCAACTCGCTG
>probe:Drosophila_2:1627287_at:726:167; Interrogation_Position=2545; Antisense; AAATGTATTTGTAGTCGTAGTGCAC
>probe:Drosophila_2:1627287_at:466:501; Interrogation_Position=2558; Antisense; GTCGTAGTGCACTGATGTAGTCTAA

Paste this into a BLAST search page for me
TCTCACGGGCGCTGAAAATGTCCTGTGAAAATGTCCTGCGCTCCAGCTATGCGCTCCAGCTATTGCAAGGATTAATTAAGAACTCAGCTCACACTTTCTCACACTTTCTCAGCACCCAATATGATAAAGCAGTGCAGGTTTGCGTCACCGGCGTCACCGCTAAGTTGTTTGCACAGTTTGCACAACCAGAAGTGGCACAGACAGATGCAGATGCGTGTCTGCGCTCGTGTCTGCGCTGTGGGAACAGATCGATCGAAAAAGTGTTCCCAGTTTGAGTTTGACTTTTATAGCAACTCGCTGAAATGTATTTGTAGTCGTAGTGCACGTCGTAGTGCACTGATGTAGTCTAA

Full Affymetrix probeset data:

Annotations for 1627287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720