FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627290_at:

>probe:Drosophila_2:1627290_at:643:627; Interrogation_Position=119; Antisense; TCCATGAACCGGCTCTGGCCAAGGT
>probe:Drosophila_2:1627290_at:286:223; Interrogation_Position=139; Antisense; AAGGTGGGCGCCATCATCAAGACCG
>probe:Drosophila_2:1627290_at:112:315; Interrogation_Position=148; Antisense; GCCATCATCAAGACCGTGCCCAGTG
>probe:Drosophila_2:1627290_at:224:665; Interrogation_Position=16; Antisense; TACAAGTTGGTGGTGTTCTTCGCTC
>probe:Drosophila_2:1627290_at:25:117; Interrogation_Position=187; Antisense; AGCATCAGCCAGGTGCACAGCTCGG
>probe:Drosophila_2:1627290_at:704:35; Interrogation_Position=217; Antisense; ATCATCCAACCGATTGTGGCTCCGG
>probe:Drosophila_2:1627290_at:52:729; Interrogation_Position=230; Antisense; TTGTGGCTCCGGTGGTGAAGACCTA
>probe:Drosophila_2:1627290_at:370:519; Interrogation_Position=241; Antisense; GTGGTGAAGACCTATGCCGCTCCCA
>probe:Drosophila_2:1627290_at:396:335; Interrogation_Position=259; Antisense; GCTCCCATCATCAAGACTTATGCGG
>probe:Drosophila_2:1627290_at:262:37; Interrogation_Position=265; Antisense; ATCATCAAGACTTATGCGGCTCCTG
>probe:Drosophila_2:1627290_at:563:643; Interrogation_Position=308; Antisense; TCTCGTCTCCGTGGGCCGGACATGG
>probe:Drosophila_2:1627290_at:412:305; Interrogation_Position=342; Antisense; CCATGGCTGGGCTCCGTCCTGGTAA
>probe:Drosophila_2:1627290_at:516:625; Interrogation_Position=57; Antisense; TGCCCGTCCGGGTTATTTGGAGTCT
>probe:Drosophila_2:1627290_at:36:703; Interrogation_Position=69; Antisense; TTATTTGGAGTCTGGTCCACTGCTC

Paste this into a BLAST search page for me
TCCATGAACCGGCTCTGGCCAAGGTAAGGTGGGCGCCATCATCAAGACCGGCCATCATCAAGACCGTGCCCAGTGTACAAGTTGGTGGTGTTCTTCGCTCAGCATCAGCCAGGTGCACAGCTCGGATCATCCAACCGATTGTGGCTCCGGTTGTGGCTCCGGTGGTGAAGACCTAGTGGTGAAGACCTATGCCGCTCCCAGCTCCCATCATCAAGACTTATGCGGATCATCAAGACTTATGCGGCTCCTGTCTCGTCTCCGTGGGCCGGACATGGCCATGGCTGGGCTCCGTCCTGGTAATGCCCGTCCGGGTTATTTGGAGTCTTTATTTGGAGTCTGGTCCACTGCTC

Full Affymetrix probeset data:

Annotations for 1627290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720