Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627291_at:

>probe:Drosophila_2:1627291_at:287:635; Interrogation_Position=1057; Antisense; TCGCATGTGCGGGAAGTCCTGGCCA
>probe:Drosophila_2:1627291_at:195:537; Interrogation_Position=1087; Antisense; GGATACGGCGACTGGTTTGTACTTA
>probe:Drosophila_2:1627291_at:339:621; Interrogation_Position=1114; Antisense; TGCGTGAGCATCAACGTCAATCCCA
>probe:Drosophila_2:1627291_at:313:11; Interrogation_Position=1206; Antisense; ATTCGCGGAGCAGCCTTGTCAGCAA
>probe:Drosophila_2:1627291_at:297:121; Interrogation_Position=1238; Antisense; AGCTGGCGCAAGTGCCGCAACTTTT
>probe:Drosophila_2:1627291_at:230:195; Interrogation_Position=1297; Antisense; AACTGCAGCCTGTTGATTGATCCCA
>probe:Drosophila_2:1627291_at:274:141; Interrogation_Position=1321; Antisense; ACGGCCGATCGTCATTCAATTTGCA
>probe:Drosophila_2:1627291_at:500:243; Interrogation_Position=1338; Antisense; AATTTGCACGGAGAGCAGCCATCGA
>probe:Drosophila_2:1627291_at:138:685; Interrogation_Position=1419; Antisense; TATCAGCATGGATCGTTTCTTCCAC
>probe:Drosophila_2:1627291_at:622:697; Interrogation_Position=1434; Antisense; TTTCTTCCACGAGAGCCACGCATAG
>probe:Drosophila_2:1627291_at:423:23; Interrogation_Position=869; Antisense; ATATCATGGACATCCTGTGCGTGCT
>probe:Drosophila_2:1627291_at:547:215; Interrogation_Position=916; Antisense; AAGATCTTCGCCGTGCTGTACGTAT
>probe:Drosophila_2:1627291_at:96:489; Interrogation_Position=933; Antisense; GTACGTATGGTTCCTGTTCATCGCG
>probe:Drosophila_2:1627291_at:417:335; Interrogation_Position=957; Antisense; GCTGCTGGCCATTATGAACATCCTT

Paste this into a BLAST search page for me
TCGCATGTGCGGGAAGTCCTGGCCAGGATACGGCGACTGGTTTGTACTTATGCGTGAGCATCAACGTCAATCCCAATTCGCGGAGCAGCCTTGTCAGCAAAGCTGGCGCAAGTGCCGCAACTTTTAACTGCAGCCTGTTGATTGATCCCAACGGCCGATCGTCATTCAATTTGCAAATTTGCACGGAGAGCAGCCATCGATATCAGCATGGATCGTTTCTTCCACTTTCTTCCACGAGAGCCACGCATAGATATCATGGACATCCTGTGCGTGCTAAGATCTTCGCCGTGCTGTACGTATGTACGTATGGTTCCTGTTCATCGCGGCTGCTGGCCATTATGAACATCCTT

Full Affymetrix probeset data:

Annotations for 1627291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime