FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627292_at:

>probe:Drosophila_2:1627292_at:91:251; Interrogation_Position=1026; Antisense; CAATCTCGCGGGTTCACCGAAGAGA
>probe:Drosophila_2:1627292_at:419:35; Interrogation_Position=533; Antisense; ATCAGCAGGCACAGCTACTGGCCAT
>probe:Drosophila_2:1627292_at:215:671; Interrogation_Position=548; Antisense; TACTGGCCATGCTGTACACGCTAAA
>probe:Drosophila_2:1627292_at:250:39; Interrogation_Position=596; Antisense; ATCTCAATGGCCTGCTATCGGTACT
>probe:Drosophila_2:1627292_at:471:161; Interrogation_Position=679; Antisense; AAACGTTTCCACAGCGGGCGGCAGT
>probe:Drosophila_2:1627292_at:296:311; Interrogation_Position=739; Antisense; GCCACGGACAAGGATGCGGTTATTA
>probe:Drosophila_2:1627292_at:526:45; Interrogation_Position=770; Antisense; ATCGCCGTCGCAAGGAGAAGTCCAA
>probe:Drosophila_2:1627292_at:120:377; Interrogation_Position=816; Antisense; GAAGAAGCCGCGTAGAACCATCACC
>probe:Drosophila_2:1627292_at:185:487; Interrogation_Position=827; Antisense; GTAGAACCATCACCGCGCAGATATA
>probe:Drosophila_2:1627292_at:205:351; Interrogation_Position=843; Antisense; GCAGATATACTGCACGCGTCGCGTT
>probe:Drosophila_2:1627292_at:134:125; Interrogation_Position=872; Antisense; AGCCCGAGGATGTTAGCTCACGGAT
>probe:Drosophila_2:1627292_at:601:545; Interrogation_Position=893; Antisense; GGATCGAGACTATCACTCCAATCGT
>probe:Drosophila_2:1627292_at:41:623; Interrogation_Position=938; Antisense; TGCGTCGCTCCTCCAACAAGAAAAG
>probe:Drosophila_2:1627292_at:663:447; Interrogation_Position=966; Antisense; GATGCCGGTCAATCGGAGCAGCATT

Paste this into a BLAST search page for me
CAATCTCGCGGGTTCACCGAAGAGAATCAGCAGGCACAGCTACTGGCCATTACTGGCCATGCTGTACACGCTAAAATCTCAATGGCCTGCTATCGGTACTAAACGTTTCCACAGCGGGCGGCAGTGCCACGGACAAGGATGCGGTTATTAATCGCCGTCGCAAGGAGAAGTCCAAGAAGAAGCCGCGTAGAACCATCACCGTAGAACCATCACCGCGCAGATATAGCAGATATACTGCACGCGTCGCGTTAGCCCGAGGATGTTAGCTCACGGATGGATCGAGACTATCACTCCAATCGTTGCGTCGCTCCTCCAACAAGAAAAGGATGCCGGTCAATCGGAGCAGCATT

Full Affymetrix probeset data:

Annotations for 1627292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720