Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627293_at:

>probe:Drosophila_2:1627293_at:224:215; Interrogation_Position=1195; Antisense; AAGATGGGCATTCGATCACGCGCCT
>probe:Drosophila_2:1627293_at:292:643; Interrogation_Position=1210; Antisense; TCACGCGCCTTTGTATTGGCTGTTA
>probe:Drosophila_2:1627293_at:685:261; Interrogation_Position=1256; Antisense; CAGCCTTCGGATCGGTCTACTTTGA
>probe:Drosophila_2:1627293_at:347:307; Interrogation_Position=1292; Antisense; CCATGATCACGCTGGGCCTGAGTTA
>probe:Drosophila_2:1627293_at:308:317; Interrogation_Position=1307; Antisense; GCCTGAGTTATTTCTTCGCCGAGAT
>probe:Drosophila_2:1627293_at:317:717; Interrogation_Position=1336; Antisense; TTCGGTATTGTCTTTGCCATTGTTG
>probe:Drosophila_2:1627293_at:547:129; Interrogation_Position=1393; Antisense; ACCATTGGCGTCTTTCTGTTTGTGA
>probe:Drosophila_2:1627293_at:473:213; Interrogation_Position=1465; Antisense; AAGATCCTGGGCTATCGCGGTTCGA
>probe:Drosophila_2:1627293_at:653:637; Interrogation_Position=1486; Antisense; TCGATCATGATCTTCTACGCTGGAT
>probe:Drosophila_2:1627293_at:209:585; Interrogation_Position=1506; Antisense; TGGATTCTACGGCATCAGTTCTATT
>probe:Drosophila_2:1627293_at:693:35; Interrogation_Position=1519; Antisense; ATCAGTTCTATTCTCTTCTTCATCA
>probe:Drosophila_2:1627293_at:60:715; Interrogation_Position=1537; Antisense; TTCATCACCTGTTTCCTGCTGGAAG
>probe:Drosophila_2:1627293_at:369:189; Interrogation_Position=1648; Antisense; AACTCCGTGTTCTCCGTGGACGAGA
>probe:Drosophila_2:1627293_at:196:545; Interrogation_Position=1732; Antisense; GGATACGACAAGTCCCAGATTTCTC

Paste this into a BLAST search page for me
AAGATGGGCATTCGATCACGCGCCTTCACGCGCCTTTGTATTGGCTGTTACAGCCTTCGGATCGGTCTACTTTGACCATGATCACGCTGGGCCTGAGTTAGCCTGAGTTATTTCTTCGCCGAGATTTCGGTATTGTCTTTGCCATTGTTGACCATTGGCGTCTTTCTGTTTGTGAAAGATCCTGGGCTATCGCGGTTCGATCGATCATGATCTTCTACGCTGGATTGGATTCTACGGCATCAGTTCTATTATCAGTTCTATTCTCTTCTTCATCATTCATCACCTGTTTCCTGCTGGAAGAACTCCGTGTTCTCCGTGGACGAGAGGATACGACAAGTCCCAGATTTCTC

Full Affymetrix probeset data:

Annotations for 1627293_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime