FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627297_at:

>probe:Drosophila_2:1627297_at:146:717; Interrogation_Position=4618; Antisense; TTCGTTTTCGTAGTCATTGTTGCTT
>probe:Drosophila_2:1627297_at:530:603; Interrogation_Position=4635; Antisense; TGTTGCTTAGCGTTTAGTCGTATAA
>probe:Drosophila_2:1627297_at:114:17; Interrogation_Position=4702; Antisense; ATTTATGTTGCCAGTGAGCGGATAC
>probe:Drosophila_2:1627297_at:422:653; Interrogation_Position=4731; Antisense; TAATTACGCAATCGCTAACACTCTC
>probe:Drosophila_2:1627297_at:466:455; Interrogation_Position=4802; Antisense; GATAATATCGTCCATTGTTCCTTCC
>probe:Drosophila_2:1627297_at:388:639; Interrogation_Position=4809; Antisense; TCGTCCATTGTTCCTTCCATATAAA
>probe:Drosophila_2:1627297_at:13:171; Interrogation_Position=4831; Antisense; AAAGGATAACGCCTTCGCACTCGCT
>probe:Drosophila_2:1627297_at:27:297; Interrogation_Position=4846; Antisense; CGCACTCGCTTTTAGCTATGGTACA
>probe:Drosophila_2:1627297_at:188:179; Interrogation_Position=4920; Antisense; AAACTACATATTACTTGCTGCATTG
>probe:Drosophila_2:1627297_at:315:715; Interrogation_Position=4950; Antisense; TTCTCGTTTTTCTATGTGTGGTCCT
>probe:Drosophila_2:1627297_at:97:63; Interrogation_Position=4963; Antisense; ATGTGTGGTCCTAGCTTGATCGAAG
>probe:Drosophila_2:1627297_at:212:5; Interrogation_Position=5007; Antisense; ATTGCACACTTTATCAACAGTCTAG
>probe:Drosophila_2:1627297_at:76:43; Interrogation_Position=5057; Antisense; ATGCACCCAAACACAACGGCTATTT
>probe:Drosophila_2:1627297_at:349:709; Interrogation_Position=5146; Antisense; TTAAACGTGCTCTTGTGTTGAACAA

Paste this into a BLAST search page for me
TTCGTTTTCGTAGTCATTGTTGCTTTGTTGCTTAGCGTTTAGTCGTATAAATTTATGTTGCCAGTGAGCGGATACTAATTACGCAATCGCTAACACTCTCGATAATATCGTCCATTGTTCCTTCCTCGTCCATTGTTCCTTCCATATAAAAAAGGATAACGCCTTCGCACTCGCTCGCACTCGCTTTTAGCTATGGTACAAAACTACATATTACTTGCTGCATTGTTCTCGTTTTTCTATGTGTGGTCCTATGTGTGGTCCTAGCTTGATCGAAGATTGCACACTTTATCAACAGTCTAGATGCACCCAAACACAACGGCTATTTTTAAACGTGCTCTTGTGTTGAACAA

Full Affymetrix probeset data:

Annotations for 1627297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720