FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627299_at:

>probe:Drosophila_2:1627299_at:287:405; Interrogation_Position=1001; Antisense; GACGAATCTCTTTTTAAACGCTAAT
>probe:Drosophila_2:1627299_at:466:197; Interrogation_Position=1106; Antisense; AACGAACATGCTGGTTTACACCCGC
>probe:Drosophila_2:1627299_at:464:707; Interrogation_Position=1121; Antisense; TTACACCCGCAGAGCCATTGAATAT
>probe:Drosophila_2:1627299_at:511:9; Interrogation_Position=1151; Antisense; ATTCCATCGATTTTCCCCTAGAGAT
>probe:Drosophila_2:1627299_at:519:83; Interrogation_Position=1170; Antisense; AGAGATAAAGGCACCTTTTCCCGCT
>probe:Drosophila_2:1627299_at:715:699; Interrogation_Position=1185; Antisense; TTTTCCCGCTCTGATTTACGATCCA
>probe:Drosophila_2:1627299_at:255:155; Interrogation_Position=1209; Antisense; ACAGTGATTTGTTGGCCTGCGCAAT
>probe:Drosophila_2:1627299_at:625:429; Interrogation_Position=1236; Antisense; GAGTTTATCTGAGTACCTGGGCCAT
>probe:Drosophila_2:1627299_at:484:131; Interrogation_Position=1250; Antisense; ACCTGGGCCATTGATAAGTTACGCA
>probe:Drosophila_2:1627299_at:289:633; Interrogation_Position=1290; Antisense; TCCCATGCCGGCGTTAATCCGATAA
>probe:Drosophila_2:1627299_at:44:619; Interrogation_Position=747; Antisense; TGCAGGGATTGTATCCACCATCCGG
>probe:Drosophila_2:1627299_at:340:575; Interrogation_Position=770; Antisense; GGCGGTTTCCTGGAGCGCATGAACA
>probe:Drosophila_2:1627299_at:252:571; Interrogation_Position=800; Antisense; GGCTATGCCCCAGGCTTTTAATTGA
>probe:Drosophila_2:1627299_at:425:569; Interrogation_Position=963; Antisense; GGCATGTCATATATCAACTCTCGTT

Paste this into a BLAST search page for me
GACGAATCTCTTTTTAAACGCTAATAACGAACATGCTGGTTTACACCCGCTTACACCCGCAGAGCCATTGAATATATTCCATCGATTTTCCCCTAGAGATAGAGATAAAGGCACCTTTTCCCGCTTTTTCCCGCTCTGATTTACGATCCAACAGTGATTTGTTGGCCTGCGCAATGAGTTTATCTGAGTACCTGGGCCATACCTGGGCCATTGATAAGTTACGCATCCCATGCCGGCGTTAATCCGATAATGCAGGGATTGTATCCACCATCCGGGGCGGTTTCCTGGAGCGCATGAACAGGCTATGCCCCAGGCTTTTAATTGAGGCATGTCATATATCAACTCTCGTT

Full Affymetrix probeset data:

Annotations for 1627299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720