Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627302_at:

>probe:Drosophila_2:1627302_at:9:375; Interrogation_Position=1059; Antisense; GAAGTTCTTCACAGGTCAGCGGAAG
>probe:Drosophila_2:1627302_at:113:509; Interrogation_Position=1079; Antisense; GGAAGTTTCCCTCCCGGGAGCAGAT
>probe:Drosophila_2:1627302_at:297:113; Interrogation_Position=1167; Antisense; AGCACATCAGATGGGCGAGCGACAG
>probe:Drosophila_2:1627302_at:118:327; Interrogation_Position=1181; Antisense; GCGAGCGACAGTTTGTCTACTACAA
>probe:Drosophila_2:1627302_at:420:55; Interrogation_Position=1205; Antisense; ATGAACTGGCCAGTATCGCGGGCAT
>probe:Drosophila_2:1627302_at:21:485; Interrogation_Position=1217; Antisense; GTATCGCGGGCATCGAGAACATCAA
>probe:Drosophila_2:1627302_at:78:385; Interrogation_Position=1233; Antisense; GAACATCAAGCCAGTTATCCACAAG
>probe:Drosophila_2:1627302_at:123:161; Interrogation_Position=1253; Antisense; ACAAGCTAATGAAGGACTGCGGCAA
>probe:Drosophila_2:1627302_at:393:363; Interrogation_Position=1291; Antisense; GAATTGGACACGTACAGGAGCAACA
>probe:Drosophila_2:1627302_at:180:381; Interrogation_Position=1373; Antisense; GAACCTGATTTCATCCCATTCTAAT
>probe:Drosophila_2:1627302_at:150:179; Interrogation_Position=1442; Antisense; GATTTAGCGGACTCTTCGGTTCGGA
>probe:Drosophila_2:1627302_at:392:293; Interrogation_Position=1557; Antisense; CGTTTATTTGCTAACCAGGAGTATA
>probe:Drosophila_2:1627302_at:426:455; Interrogation_Position=1585; Antisense; GATAATGTCCACCATAGCTCTTTAA
>probe:Drosophila_2:1627302_at:589:115; Interrogation_Position=1600; Antisense; AGCTCTTTAATTCTAAGCCTCGTAG

Paste this into a BLAST search page for me
GAAGTTCTTCACAGGTCAGCGGAAGGGAAGTTTCCCTCCCGGGAGCAGATAGCACATCAGATGGGCGAGCGACAGGCGAGCGACAGTTTGTCTACTACAAATGAACTGGCCAGTATCGCGGGCATGTATCGCGGGCATCGAGAACATCAAGAACATCAAGCCAGTTATCCACAAGACAAGCTAATGAAGGACTGCGGCAAGAATTGGACACGTACAGGAGCAACAGAACCTGATTTCATCCCATTCTAATGATTTAGCGGACTCTTCGGTTCGGACGTTTATTTGCTAACCAGGAGTATAGATAATGTCCACCATAGCTCTTTAAAGCTCTTTAATTCTAAGCCTCGTAG

Full Affymetrix probeset data:

Annotations for 1627302_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime