FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627305_at:

>probe:Drosophila_2:1627305_at:122:453; Interrogation_Position=354; Antisense; GATCTCATGCTACTTGATGGGCTAC
>probe:Drosophila_2:1627305_at:597:99; Interrogation_Position=416; Antisense; AGATGGCCGGTGCTTTCCTTGGTTA
>probe:Drosophila_2:1627305_at:206:275; Interrogation_Position=433; Antisense; CTTGGTTACTTCCTGCTAATGCAAC
>probe:Drosophila_2:1627305_at:624:655; Interrogation_Position=449; Antisense; TAATGCAACTGCTGCCCAAGGAGCT
>probe:Drosophila_2:1627305_at:198:287; Interrogation_Position=502; Antisense; CTGGTACAACCGATGGACACTCTGT
>probe:Drosophila_2:1627305_at:91:27; Interrogation_Position=531; Antisense; ATACCAGGTCGTCATCATCGAGTGC
>probe:Drosophila_2:1627305_at:96:451; Interrogation_Position=654; Antisense; GATCGCTTGCAGTTTCGCAGGGATT
>probe:Drosophila_2:1627305_at:343:105; Interrogation_Position=710; Antisense; AGACATTGGTGCCTGCCATATTCTA
>probe:Drosophila_2:1627305_at:361:687; Interrogation_Position=728; Antisense; TATTCTACGGCAGTCCGAATTCGGT
>probe:Drosophila_2:1627305_at:289:363; Interrogation_Position=744; Antisense; GAATTCGGTTCTAATGCAGCTGACT
>probe:Drosophila_2:1627305_at:691:321; Interrogation_Position=795; Antisense; GCCCTTCGTGTGGAATCATGCGTAT
>probe:Drosophila_2:1627305_at:256:671; Interrogation_Position=819; Antisense; TACGCCACCTTATAAGCCCTTGGAA
>probe:Drosophila_2:1627305_at:579:653; Interrogation_Position=878; Antisense; TAAGCTCGACGTTTTTGGCTACCGT
>probe:Drosophila_2:1627305_at:316:341; Interrogation_Position=895; Antisense; GCTACCGTGTGGCTTATTTGATCAA

Paste this into a BLAST search page for me
GATCTCATGCTACTTGATGGGCTACAGATGGCCGGTGCTTTCCTTGGTTACTTGGTTACTTCCTGCTAATGCAACTAATGCAACTGCTGCCCAAGGAGCTCTGGTACAACCGATGGACACTCTGTATACCAGGTCGTCATCATCGAGTGCGATCGCTTGCAGTTTCGCAGGGATTAGACATTGGTGCCTGCCATATTCTATATTCTACGGCAGTCCGAATTCGGTGAATTCGGTTCTAATGCAGCTGACTGCCCTTCGTGTGGAATCATGCGTATTACGCCACCTTATAAGCCCTTGGAATAAGCTCGACGTTTTTGGCTACCGTGCTACCGTGTGGCTTATTTGATCAA

Full Affymetrix probeset data:

Annotations for 1627305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720