FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627307_at:

>probe:Drosophila_2:1627307_at:423:569; Interrogation_Position=1166; Antisense; GGCAGGATTATTCCCTTCATATAAA
>probe:Drosophila_2:1627307_at:711:169; Interrogation_Position=1212; Antisense; AAAGGTAACCATTTCTAGTATTGAT
>probe:Drosophila_2:1627307_at:624:389; Interrogation_Position=1273; Antisense; GAAACATCTGGAACACAACCTATTA
>probe:Drosophila_2:1627307_at:647:231; Interrogation_Position=1312; Antisense; AATGAATCAGGTGGCCATAAACTCA
>probe:Drosophila_2:1627307_at:438:7; Interrogation_Position=1349; Antisense; ATTCCAATAGCATTAAACGTCGATT
>probe:Drosophila_2:1627307_at:518:137; Interrogation_Position=1365; Antisense; ACGTCGATTCCAATTTCCGAAAGAT
>probe:Drosophila_2:1627307_at:730:245; Interrogation_Position=1381; Antisense; CCGAAAGATTTACATGGGACCCAAT
>probe:Drosophila_2:1627307_at:516:63; Interrogation_Position=1394; Antisense; ATGGGACCCAATCATTAGAGTTTGA
>probe:Drosophila_2:1627307_at:209:563; Interrogation_Position=1425; Antisense; GGAATGTCTAGATCAATACACGAGT
>probe:Drosophila_2:1627307_at:66:549; Interrogation_Position=1450; Antisense; GGAGGTATGAAAGCTGCACCAGAAA
>probe:Drosophila_2:1627307_at:478:367; Interrogation_Position=1492; Antisense; GAATCCTCTGAACGGATGTCCAAGT
>probe:Drosophila_2:1627307_at:413:387; Interrogation_Position=1525; Antisense; GAAAATGACTTGGTTTCCTGTCCTC
>probe:Drosophila_2:1627307_at:28:695; Interrogation_Position=1538; Antisense; TTTCCTGTCCTCCTTTTAAGAATAT
>probe:Drosophila_2:1627307_at:513:705; Interrogation_Position=1606; Antisense; TTAGGACCATGTTGATCTGAGCGCA

Paste this into a BLAST search page for me
GGCAGGATTATTCCCTTCATATAAAAAAGGTAACCATTTCTAGTATTGATGAAACATCTGGAACACAACCTATTAAATGAATCAGGTGGCCATAAACTCAATTCCAATAGCATTAAACGTCGATTACGTCGATTCCAATTTCCGAAAGATCCGAAAGATTTACATGGGACCCAATATGGGACCCAATCATTAGAGTTTGAGGAATGTCTAGATCAATACACGAGTGGAGGTATGAAAGCTGCACCAGAAAGAATCCTCTGAACGGATGTCCAAGTGAAAATGACTTGGTTTCCTGTCCTCTTTCCTGTCCTCCTTTTAAGAATATTTAGGACCATGTTGATCTGAGCGCA

Full Affymetrix probeset data:

Annotations for 1627307_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720