Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627308_s_at:

>probe:Drosophila_2:1627308_s_at:446:563; Interrogation_Position=141; Antisense; GGCAATACCGCCAACTAACGAAATT
>probe:Drosophila_2:1627308_s_at:90:397; Interrogation_Position=160; Antisense; GAAATTGCATCGTTCGCCAAGACCT
>probe:Drosophila_2:1627308_s_at:85:283; Interrogation_Position=186; Antisense; CTCGCCCGGATAAAGCAAGACGTTT
>probe:Drosophila_2:1627308_s_at:497:459; Interrogation_Position=238; Antisense; GATTTATAGAATCCGTGTTCGCCGC
>probe:Drosophila_2:1627308_s_at:281:207; Interrogation_Position=272; Antisense; AAGCGTCCAGTTCCCAAAGGATGCA
>probe:Drosophila_2:1627308_s_at:383:23; Interrogation_Position=340; Antisense; ATATCGTGGTTTGCAATCCATTGCT
>probe:Drosophila_2:1627308_s_at:186:145; Interrogation_Position=385; Antisense; ACTTGGCGGCTTGCGAGTTTTGAAC
>probe:Drosophila_2:1627308_s_at:510:539; Interrogation_Position=417; Antisense; GGATTGCGCAAGATGCTTCTTATAA
>probe:Drosophila_2:1627308_s_at:527:153; Interrogation_Position=474; Antisense; ACAGTGCTATTCGTCGTGATCCAAA
>probe:Drosophila_2:1627308_s_at:625:545; Interrogation_Position=507; Antisense; GGATCTGCAAGCATGTCCACAAGCA
>probe:Drosophila_2:1627308_s_at:555:329; Interrogation_Position=541; Antisense; GCGTGGCCTTACATCAGCTGGAAAA
>probe:Drosophila_2:1627308_s_at:214:389; Interrogation_Position=561; Antisense; GAAAAAGTTCGCGTGGCATTGGCAA
>probe:Drosophila_2:1627308_s_at:169:249; Interrogation_Position=607; Antisense; AATTGGTGGATCTAGGCGTGCTGCT
>probe:Drosophila_2:1627308_s_at:264:563; Interrogation_Position=633; Antisense; GGAAGCGCAAGAACCGTGAGCACAT

Paste this into a BLAST search page for me
GGCAATACCGCCAACTAACGAAATTGAAATTGCATCGTTCGCCAAGACCTCTCGCCCGGATAAAGCAAGACGTTTGATTTATAGAATCCGTGTTCGCCGCAAGCGTCCAGTTCCCAAAGGATGCAATATCGTGGTTTGCAATCCATTGCTACTTGGCGGCTTGCGAGTTTTGAACGGATTGCGCAAGATGCTTCTTATAAACAGTGCTATTCGTCGTGATCCAAAGGATCTGCAAGCATGTCCACAAGCAGCGTGGCCTTACATCAGCTGGAAAAGAAAAAGTTCGCGTGGCATTGGCAAAATTGGTGGATCTAGGCGTGCTGCTGGAAGCGCAAGAACCGTGAGCACAT

Full Affymetrix probeset data:

Annotations for 1627308_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime