FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627311_at:

>probe:Drosophila_2:1627311_at:59:311; Interrogation_Position=433; Antisense; GCCAAGATTCTTGGGCCCGGGCTAT
>probe:Drosophila_2:1627311_at:217:393; Interrogation_Position=474; Antisense; GAAAGCTCGGCTTCGCGTTGCGACA
>probe:Drosophila_2:1627311_at:98:189; Interrogation_Position=522; Antisense; AACAGGAATGTCGTCCAACTGCATG
>probe:Drosophila_2:1627311_at:299:619; Interrogation_Position=541; Antisense; TGCATGGCCAACGATCAGAGTTCCA
>probe:Drosophila_2:1627311_at:516:253; Interrogation_Position=584; Antisense; CAAAGGGTTTTGAGCACTCTCCCAA
>probe:Drosophila_2:1627311_at:230:479; Interrogation_Position=611; Antisense; GTTTGGCTTCACTACAGTGTACTGG
>probe:Drosophila_2:1627311_at:387:515; Interrogation_Position=627; Antisense; GTGTACTGGTGTTCTGATATTCGAT
>probe:Drosophila_2:1627311_at:259:361; Interrogation_Position=661; Antisense; GAATTGTTTGGCACTTTACTGCCTG
>probe:Drosophila_2:1627311_at:161:707; Interrogation_Position=676; Antisense; TTACTGCCTGGCAACCGGGTTGATA
>probe:Drosophila_2:1627311_at:412:603; Interrogation_Position=696; Antisense; TGATAAGGCAGCTCACTCGGGTGAT
>probe:Drosophila_2:1627311_at:573:95; Interrogation_Position=722; Antisense; AGATTCCTGACGAAGCTGGAGCGGA
>probe:Drosophila_2:1627311_at:412:351; Interrogation_Position=751; Antisense; GCAGCTGGAGGTTTGGTACATCTTA
>probe:Drosophila_2:1627311_at:44:603; Interrogation_Position=799; Antisense; TGTTTTGACGATTTGCTTTGCACTT
>probe:Drosophila_2:1627311_at:112:617; Interrogation_Position=817; Antisense; TGCACTTTGTCTCGCGGGTGGATCA

Paste this into a BLAST search page for me
GCCAAGATTCTTGGGCCCGGGCTATGAAAGCTCGGCTTCGCGTTGCGACAAACAGGAATGTCGTCCAACTGCATGTGCATGGCCAACGATCAGAGTTCCACAAAGGGTTTTGAGCACTCTCCCAAGTTTGGCTTCACTACAGTGTACTGGGTGTACTGGTGTTCTGATATTCGATGAATTGTTTGGCACTTTACTGCCTGTTACTGCCTGGCAACCGGGTTGATATGATAAGGCAGCTCACTCGGGTGATAGATTCCTGACGAAGCTGGAGCGGAGCAGCTGGAGGTTTGGTACATCTTATGTTTTGACGATTTGCTTTGCACTTTGCACTTTGTCTCGCGGGTGGATCA

Full Affymetrix probeset data:

Annotations for 1627311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720