FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627312_at:

>probe:Drosophila_2:1627312_at:170:655; Interrogation_Position=626; Antisense; TAATAATTGACCCAATCGGACAGAA
>probe:Drosophila_2:1627312_at:365:245; Interrogation_Position=630; Antisense; AATTGACCCAATCGGACAGAATTTT
>probe:Drosophila_2:1627312_at:639:411; Interrogation_Position=634; Antisense; GACCCAATCGGACAGAATTTTACTT
>probe:Drosophila_2:1627312_at:261:559; Interrogation_Position=643; Antisense; GGACAGAATTTTACTTTCGAGCTCA
>probe:Drosophila_2:1627312_at:603:147; Interrogation_Position=655; Antisense; ACTTTCGAGCTCAATGCGGCCGTGA
>probe:Drosophila_2:1627312_at:45:717; Interrogation_Position=658; Antisense; TTCGAGCTCAATGCGGCCGTGAATG
>probe:Drosophila_2:1627312_at:240:653; Interrogation_Position=665; Antisense; TCAATGCGGCCGTGAATGCGATTTC
>probe:Drosophila_2:1627312_at:430:233; Interrogation_Position=667; Antisense; AATGCGGCCGTGAATGCGATTTCAG
>probe:Drosophila_2:1627312_at:15:333; Interrogation_Position=670; Antisense; GCGGCCGTGAATGCGATTTCAGATA
>probe:Drosophila_2:1627312_at:166:369; Interrogation_Position=678; Antisense; GAATGCGATTTCAGATAGGCTAGCT
>probe:Drosophila_2:1627312_at:590:51; Interrogation_Position=680; Antisense; ATGCGATTTCAGATAGGCTAGCTAA
>probe:Drosophila_2:1627312_at:475:327; Interrogation_Position=682; Antisense; GCGATTTCAGATAGGCTAGCTAAAT
>probe:Drosophila_2:1627312_at:694:1; Interrogation_Position=692; Antisense; ATAGGCTAGCTAAATGTTAAACAAG
>probe:Drosophila_2:1627312_at:181:251; Interrogation_Position=713; Antisense; CAAGAGGAAAACTAGAAGTGCATAA

Paste this into a BLAST search page for me
TAATAATTGACCCAATCGGACAGAAAATTGACCCAATCGGACAGAATTTTGACCCAATCGGACAGAATTTTACTTGGACAGAATTTTACTTTCGAGCTCAACTTTCGAGCTCAATGCGGCCGTGATTCGAGCTCAATGCGGCCGTGAATGTCAATGCGGCCGTGAATGCGATTTCAATGCGGCCGTGAATGCGATTTCAGGCGGCCGTGAATGCGATTTCAGATAGAATGCGATTTCAGATAGGCTAGCTATGCGATTTCAGATAGGCTAGCTAAGCGATTTCAGATAGGCTAGCTAAATATAGGCTAGCTAAATGTTAAACAAGCAAGAGGAAAACTAGAAGTGCATAA

Full Affymetrix probeset data:

Annotations for 1627312_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720