FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627313_at:

>probe:Drosophila_2:1627313_at:655:553; Interrogation_Position=1056; Antisense; GGAGCCACGCCATTGGGTACAGGAT
>probe:Drosophila_2:1627313_at:536:453; Interrogation_Position=1078; Antisense; GATCATACCTGTGACTACCATCGGA
>probe:Drosophila_2:1627313_at:618:119; Interrogation_Position=1112; Antisense; AGCTGTGTCCAAATATGCGTTTCAT
>probe:Drosophila_2:1627313_at:163:663; Interrogation_Position=1163; Antisense; TAAAACGCCTGTCGATTGGACCCGA
>probe:Drosophila_2:1627313_at:279:671; Interrogation_Position=1194; Antisense; TACGTGTTTCAAGCATACCAGGGAT
>probe:Drosophila_2:1627313_at:167:519; Interrogation_Position=664; Antisense; GGGCGCATTTCCATTTCAATTTTGC
>probe:Drosophila_2:1627313_at:294:527; Interrogation_Position=704; Antisense; GGGAATTCCTGTGCCTCAGCGAAAC
>probe:Drosophila_2:1627313_at:79:3; Interrogation_Position=799; Antisense; ATACGACGTTCGAGCACCTATAGGG
>probe:Drosophila_2:1627313_at:236:219; Interrogation_Position=828; Antisense; AAGTCAAATTCGCTTCAGCTTCCTG
>probe:Drosophila_2:1627313_at:642:437; Interrogation_Position=883; Antisense; GAGGAACTCCATAAGATGCCCGAAT
>probe:Drosophila_2:1627313_at:119:77; Interrogation_Position=923; Antisense; AGGAGTTTAGCAAGTCGCCCGATGT
>probe:Drosophila_2:1627313_at:343:275; Interrogation_Position=955; Antisense; CTTCTGCGGGACTCGGTGTTTAACA
>probe:Drosophila_2:1627313_at:460:151; Interrogation_Position=977; Antisense; ACAGCAGTTTGCTCTTAACCGTGCG
>probe:Drosophila_2:1627313_at:252:659; Interrogation_Position=992; Antisense; TAACCGTGCGCAACAATCCGAGTGT

Paste this into a BLAST search page for me
GGAGCCACGCCATTGGGTACAGGATGATCATACCTGTGACTACCATCGGAAGCTGTGTCCAAATATGCGTTTCATTAAAACGCCTGTCGATTGGACCCGATACGTGTTTCAAGCATACCAGGGATGGGCGCATTTCCATTTCAATTTTGCGGGAATTCCTGTGCCTCAGCGAAACATACGACGTTCGAGCACCTATAGGGAAGTCAAATTCGCTTCAGCTTCCTGGAGGAACTCCATAAGATGCCCGAATAGGAGTTTAGCAAGTCGCCCGATGTCTTCTGCGGGACTCGGTGTTTAACAACAGCAGTTTGCTCTTAACCGTGCGTAACCGTGCGCAACAATCCGAGTGT

Full Affymetrix probeset data:

Annotations for 1627313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720