FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627319_at:

>probe:Drosophila_2:1627319_at:327:501; Interrogation_Position=153; Antisense; GTCGTTCTCCTGATGAGCCTGCAAA
>probe:Drosophila_2:1627319_at:9:547; Interrogation_Position=193; Antisense; GGATCGAGTGCTACGTGTGCGACAC
>probe:Drosophila_2:1627319_at:376:399; Interrogation_Position=213; Antisense; GACACGAGCGATACGGAGCATCCGT
>probe:Drosophila_2:1627319_at:250:113; Interrogation_Position=229; Antisense; AGCATCCGTTCCAGTGCGGCGAGTG
>probe:Drosophila_2:1627319_at:581:327; Interrogation_Position=260; Antisense; GCGATACGACATACCGGACATTCAA
>probe:Drosophila_2:1627319_at:255:163; Interrogation_Position=290; Antisense; AAATTGTTCCAGTGTCCATGGCGCC
>probe:Drosophila_2:1627319_at:221:69; Interrogation_Position=307; Antisense; ATGGCGCCCAGTTCTGTGTGAAGCA
>probe:Drosophila_2:1627319_at:181:101; Interrogation_Position=364; Antisense; AGAGGTTCTGCAGTTCGAAGGACAT
>probe:Drosophila_2:1627319_at:573:557; Interrogation_Position=383; Antisense; GGACATGGGCAACTATTGTGACTAT
>probe:Drosophila_2:1627319_at:145:45; Interrogation_Position=436; Antisense; ATCGCAGCTGCATTTACACTTGTGA
>probe:Drosophila_2:1627319_at:445:141; Interrogation_Position=462; Antisense; ACGGACGGTTGCAATGCCGCTGGAA
>probe:Drosophila_2:1627319_at:619:257; Interrogation_Position=530; Antisense; CACATGGCTCTTACGGCACTGACAG
>probe:Drosophila_2:1627319_at:439:355; Interrogation_Position=545; Antisense; GCACTGACAGCATCGGGCGGATAGA
>probe:Drosophila_2:1627319_at:600:119; Interrogation_Position=585; Antisense; AGCTGCATCGCTACATTAATTTTTT

Paste this into a BLAST search page for me
GTCGTTCTCCTGATGAGCCTGCAAAGGATCGAGTGCTACGTGTGCGACACGACACGAGCGATACGGAGCATCCGTAGCATCCGTTCCAGTGCGGCGAGTGGCGATACGACATACCGGACATTCAAAAATTGTTCCAGTGTCCATGGCGCCATGGCGCCCAGTTCTGTGTGAAGCAAGAGGTTCTGCAGTTCGAAGGACATGGACATGGGCAACTATTGTGACTATATCGCAGCTGCATTTACACTTGTGAACGGACGGTTGCAATGCCGCTGGAACACATGGCTCTTACGGCACTGACAGGCACTGACAGCATCGGGCGGATAGAAGCTGCATCGCTACATTAATTTTTT

Full Affymetrix probeset data:

Annotations for 1627319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720