Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627320_at:

>probe:Drosophila_2:1627320_at:271:325; Interrogation_Position=10022; Antisense; GCGAAATCTCAGCTTATATGGTACG
>probe:Drosophila_2:1627320_at:460:341; Interrogation_Position=10033; Antisense; GCTTATATGGTACGTTTACTTACAT
>probe:Drosophila_2:1627320_at:95:163; Interrogation_Position=10069; Antisense; AAATATTCCTTGTCAATGTAACTAT
>probe:Drosophila_2:1627320_at:395:677; Interrogation_Position=10190; Antisense; TATACAGCCCTATATTTATTTTATT
>probe:Drosophila_2:1627320_at:316:15; Interrogation_Position=9671; Antisense; ATTATTTACGTCATTCTTATGGTGA
>probe:Drosophila_2:1627320_at:526:645; Interrogation_Position=9685; Antisense; TCTTATGGTGAGAGAATCGTGCCAA
>probe:Drosophila_2:1627320_at:576:365; Interrogation_Position=9698; Antisense; GAATCGTGCCAATAATTTGTTCTGC
>probe:Drosophila_2:1627320_at:416:349; Interrogation_Position=9721; Antisense; GCAGAAAATTCCAATTTCCGTATGA
>probe:Drosophila_2:1627320_at:9:165; Interrogation_Position=9790; Antisense; AAATCATGAATTTTGTTTCGACCTA
>probe:Drosophila_2:1627320_at:397:479; Interrogation_Position=9804; Antisense; GTTTCGACCTATATCACAGTTTCCT
>probe:Drosophila_2:1627320_at:359:1; Interrogation_Position=9816; Antisense; ATCACAGTTTCCTTGTTAAGTAATT
>probe:Drosophila_2:1627320_at:340:317; Interrogation_Position=9846; Antisense; GCCGTATTAAGCAATTCATTCACAG
>probe:Drosophila_2:1627320_at:309:529; Interrogation_Position=9957; Antisense; GGGTTACTATTTCACAATTGTATAA
>probe:Drosophila_2:1627320_at:591:709; Interrogation_Position=9989; Antisense; TTAAATCTTCCAATACACAACATAG

Paste this into a BLAST search page for me
GCGAAATCTCAGCTTATATGGTACGGCTTATATGGTACGTTTACTTACATAAATATTCCTTGTCAATGTAACTATTATACAGCCCTATATTTATTTTATTATTATTTACGTCATTCTTATGGTGATCTTATGGTGAGAGAATCGTGCCAAGAATCGTGCCAATAATTTGTTCTGCGCAGAAAATTCCAATTTCCGTATGAAAATCATGAATTTTGTTTCGACCTAGTTTCGACCTATATCACAGTTTCCTATCACAGTTTCCTTGTTAAGTAATTGCCGTATTAAGCAATTCATTCACAGGGGTTACTATTTCACAATTGTATAATTAAATCTTCCAATACACAACATAG

Full Affymetrix probeset data:

Annotations for 1627320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime