Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627321_x_at:

>probe:Drosophila_2:1627321_x_at:201:543; Interrogation_Position=538; Antisense; GGATTCACCCAGATTGTTGCCTAGA
>probe:Drosophila_2:1627321_x_at:229:463; Interrogation_Position=539; Antisense; GATTCACCCAGATTGTTGCCTAGAG
>probe:Drosophila_2:1627321_x_at:52:13; Interrogation_Position=540; Antisense; ATTCACCCAGATTGTTGCCTAGAGT
>probe:Drosophila_2:1627321_x_at:41:651; Interrogation_Position=542; Antisense; TCACCCAGATTGTTGCCTAGAGTTT
>probe:Drosophila_2:1627321_x_at:706:133; Interrogation_Position=544; Antisense; ACCCAGATTGTTGCCTAGAGTTTTC
>probe:Drosophila_2:1627321_x_at:634:307; Interrogation_Position=546; Antisense; CCAGATTGTTGCCTAGAGTTTTCAT
>probe:Drosophila_2:1627321_x_at:596:463; Interrogation_Position=549; Antisense; GATTGTTGCCTAGAGTTTTCATTTG
>probe:Drosophila_2:1627321_x_at:381:469; Interrogation_Position=553; Antisense; GTTGCCTAGAGTTTTCATTTGCTGA
>probe:Drosophila_2:1627321_x_at:658:675; Interrogation_Position=559; Antisense; TAGAGTTTTCATTTGCTGACGCTGC
>probe:Drosophila_2:1627321_x_at:33:93; Interrogation_Position=562; Antisense; AGTTTTCATTTGCTGACGCTGCTGT
>probe:Drosophila_2:1627321_x_at:497:697; Interrogation_Position=565; Antisense; TTTCATTTGCTGACGCTGCTGTCGC
>probe:Drosophila_2:1627321_x_at:702:19; Interrogation_Position=569; Antisense; ATTTGCTGACGCTGCTGTCGCCTGT
>probe:Drosophila_2:1627321_x_at:311:269; Interrogation_Position=682; Antisense; CTCCCGACCCAACCGTAGCATCTAA
>probe:Drosophila_2:1627321_x_at:208:297; Interrogation_Position=683; Antisense; TCCCGACCCAACCGTAGCATCTAAC

Paste this into a BLAST search page for me
GGATTCACCCAGATTGTTGCCTAGAGATTCACCCAGATTGTTGCCTAGAGATTCACCCAGATTGTTGCCTAGAGTTCACCCAGATTGTTGCCTAGAGTTTACCCAGATTGTTGCCTAGAGTTTTCCCAGATTGTTGCCTAGAGTTTTCATGATTGTTGCCTAGAGTTTTCATTTGGTTGCCTAGAGTTTTCATTTGCTGATAGAGTTTTCATTTGCTGACGCTGCAGTTTTCATTTGCTGACGCTGCTGTTTTCATTTGCTGACGCTGCTGTCGCATTTGCTGACGCTGCTGTCGCCTGTCTCCCGACCCAACCGTAGCATCTAATCCCGACCCAACCGTAGCATCTAAC

Full Affymetrix probeset data:

Annotations for 1627321_x_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime