FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627322_at:

>probe:Drosophila_2:1627322_at:373:729; Interrogation_Position=109; Antisense; TTGGACAGACCTATACGCATCACTT
>probe:Drosophila_2:1627322_at:685:215; Interrogation_Position=13; Antisense; AAGTTGTTGCCCTGTTTGCCACCGT
>probe:Drosophila_2:1627322_at:328:147; Interrogation_Position=130; Antisense; ACTTCGATGCCGCTAAGTACTGGCT
>probe:Drosophila_2:1627322_at:310:657; Interrogation_Position=143; Antisense; TAAGTACTGGCTGTGCGAGACCCTT
>probe:Drosophila_2:1627322_at:595:595; Interrogation_Position=154; Antisense; TGTGCGAGACCCTTGGCGTTCCGGC
>probe:Drosophila_2:1627322_at:183:581; Interrogation_Position=205; Antisense; TGGCCTACATGCATCTGCTCAAGGA
>probe:Drosophila_2:1627322_at:520:651; Interrogation_Position=223; Antisense; TCAAGGAGTGCATCCCATGGGCCAG
>probe:Drosophila_2:1627322_at:290:633; Interrogation_Position=235; Antisense; TCCCATGGGCCAGTTACATCTGGAA
>probe:Drosophila_2:1627322_at:255:93; Interrogation_Position=246; Antisense; AGTTACATCTGGAAGAAGCCCGAGA
>probe:Drosophila_2:1627322_at:511:379; Interrogation_Position=260; Antisense; GAAGCCCGAGATGCCACCAACTGTG
>probe:Drosophila_2:1627322_at:358:695; Interrogation_Position=27; Antisense; TTTGCCACCGTTTTGGCCATTATTT
>probe:Drosophila_2:1627322_at:54:273; Interrogation_Position=44; Antisense; CATTATTTTGGTGGCTGGAGTGAGT
>probe:Drosophila_2:1627322_at:280:537; Interrogation_Position=78; Antisense; GGTCGCTCCGCCTGCAAGGATGAGT
>probe:Drosophila_2:1627322_at:622:443; Interrogation_Position=96; Antisense; GATGAGTCCGAGATTGGACAGACCT

Paste this into a BLAST search page for me
TTGGACAGACCTATACGCATCACTTAAGTTGTTGCCCTGTTTGCCACCGTACTTCGATGCCGCTAAGTACTGGCTTAAGTACTGGCTGTGCGAGACCCTTTGTGCGAGACCCTTGGCGTTCCGGCTGGCCTACATGCATCTGCTCAAGGATCAAGGAGTGCATCCCATGGGCCAGTCCCATGGGCCAGTTACATCTGGAAAGTTACATCTGGAAGAAGCCCGAGAGAAGCCCGAGATGCCACCAACTGTGTTTGCCACCGTTTTGGCCATTATTTCATTATTTTGGTGGCTGGAGTGAGTGGTCGCTCCGCCTGCAAGGATGAGTGATGAGTCCGAGATTGGACAGACCT

Full Affymetrix probeset data:

Annotations for 1627322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720