FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627323_at:

>probe:Drosophila_2:1627323_at:73:35; Interrogation_Position=1238; Antisense; ATCAAATGCCACTTGTGCGACTCAA
>probe:Drosophila_2:1627323_at:416:623; Interrogation_Position=1253; Antisense; TGCGACTCAATGCTAACCACCAAAT
>probe:Drosophila_2:1627323_at:451:407; Interrogation_Position=1281; Antisense; GACTGGCCCGCCACATAAAAATGAT
>probe:Drosophila_2:1627323_at:108:447; Interrogation_Position=1303; Antisense; GATGCATACCGCTGAGAACCTGCAG
>probe:Drosophila_2:1627323_at:614:727; Interrogation_Position=1345; Antisense; TTGTCTTAAGATATGCCCCAGTCTA
>probe:Drosophila_2:1627323_at:715:489; Interrogation_Position=1393; Antisense; GTACACCCACAATACGGCACGTAGT
>probe:Drosophila_2:1627323_at:21:567; Interrogation_Position=1408; Antisense; GGCACGTAGTCATCAGTGTCCTATG
>probe:Drosophila_2:1627323_at:447:73; Interrogation_Position=1467; Antisense; AGGAACACATGACAACCCACACGGG
>probe:Drosophila_2:1627323_at:703:257; Interrogation_Position=1484; Antisense; CACACGGGCGAGGTTTTGTACACAT
>probe:Drosophila_2:1627323_at:482:623; Interrogation_Position=1517; Antisense; TGCCCGCAAACCTTCAATTCAAATG
>probe:Drosophila_2:1627323_at:46:423; Interrogation_Position=1589; Antisense; GAGAACCGACACAAGCGACTGAATC
>probe:Drosophila_2:1627323_at:395:471; Interrogation_Position=1614; Antisense; GTTCTCGCAAATCAGACACCATCAT
>probe:Drosophila_2:1627323_at:682:33; Interrogation_Position=1634; Antisense; ATCATCGCCGTCAGCGTACGAAAGA
>probe:Drosophila_2:1627323_at:402:305; Interrogation_Position=1740; Antisense; CCTAGGTGACCTTTTGACGCAATAA

Paste this into a BLAST search page for me
ATCAAATGCCACTTGTGCGACTCAATGCGACTCAATGCTAACCACCAAATGACTGGCCCGCCACATAAAAATGATGATGCATACCGCTGAGAACCTGCAGTTGTCTTAAGATATGCCCCAGTCTAGTACACCCACAATACGGCACGTAGTGGCACGTAGTCATCAGTGTCCTATGAGGAACACATGACAACCCACACGGGCACACGGGCGAGGTTTTGTACACATTGCCCGCAAACCTTCAATTCAAATGGAGAACCGACACAAGCGACTGAATCGTTCTCGCAAATCAGACACCATCATATCATCGCCGTCAGCGTACGAAAGACCTAGGTGACCTTTTGACGCAATAA

Full Affymetrix probeset data:

Annotations for 1627323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720