Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627324_at:

>probe:Drosophila_2:1627324_at:191:529; Interrogation_Position=1812; Antisense; GGGATCCCCAAGATGAAGCTGGCCA
>probe:Drosophila_2:1627324_at:557:251; Interrogation_Position=1820; Antisense; CAAGATGAAGCTGGCCAGAACGAAG
>probe:Drosophila_2:1627324_at:133:513; Interrogation_Position=1848; Antisense; GTGAGTCCAGGATTCGAGTCCGTAA
>probe:Drosophila_2:1627324_at:391:541; Interrogation_Position=1857; Antisense; GGATTCGAGTCCGTAATTGGCTAAT
>probe:Drosophila_2:1627324_at:216:293; Interrogation_Position=1868; Antisense; CGTAATTGGCTAATGCTGGCTGACA
>probe:Drosophila_2:1627324_at:363:333; Interrogation_Position=1882; Antisense; GCTGGCTGACAAATCCATCATTGGA
>probe:Drosophila_2:1627324_at:364:725; Interrogation_Position=1902; Antisense; TTGGAAAATCCTCAGACGAGCCCTC
>probe:Drosophila_2:1627324_at:229:137; Interrogation_Position=1917; Antisense; ACGAGCCCTCAGTCTTACATATTGT
>probe:Drosophila_2:1627324_at:201:321; Interrogation_Position=1921; Antisense; GCCCTCAGTCTTACATATTGTTTTG
>probe:Drosophila_2:1627324_at:321:477; Interrogation_Position=1940; Antisense; GTTTTGTTGCTGAGCACACACAGAC
>probe:Drosophila_2:1627324_at:357:421; Interrogation_Position=1951; Antisense; GAGCACACACAGACACATCATAAGT
>probe:Drosophila_2:1627324_at:166:217; Interrogation_Position=1972; Antisense; AAGTTTCTTACTCATTATCCAATCA
>probe:Drosophila_2:1627324_at:639:201; Interrogation_Position=2022; Antisense; AACCATTCCCAATTTCTATTTCATG
>probe:Drosophila_2:1627324_at:180:19; Interrogation_Position=2033; Antisense; ATTTCTATTTCATGACTAACCAAAC

Paste this into a BLAST search page for me
GGGATCCCCAAGATGAAGCTGGCCACAAGATGAAGCTGGCCAGAACGAAGGTGAGTCCAGGATTCGAGTCCGTAAGGATTCGAGTCCGTAATTGGCTAATCGTAATTGGCTAATGCTGGCTGACAGCTGGCTGACAAATCCATCATTGGATTGGAAAATCCTCAGACGAGCCCTCACGAGCCCTCAGTCTTACATATTGTGCCCTCAGTCTTACATATTGTTTTGGTTTTGTTGCTGAGCACACACAGACGAGCACACACAGACACATCATAAGTAAGTTTCTTACTCATTATCCAATCAAACCATTCCCAATTTCTATTTCATGATTTCTATTTCATGACTAACCAAAC

Full Affymetrix probeset data:

Annotations for 1627324_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime