FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627325_at:

>probe:Drosophila_2:1627325_at:157:289; Interrogation_Position=1019; Antisense; CGGAGAACTTGCTGCTCGGGCACAA
>probe:Drosophila_2:1627325_at:676:221; Interrogation_Position=1042; Antisense; AAGGGCGTCCTGAAGATCGCCGACT
>probe:Drosophila_2:1627325_at:254:143; Interrogation_Position=1107; Antisense; ACTGTGCGGCACTGTCGACTACTTG
>probe:Drosophila_2:1627325_at:565:665; Interrogation_Position=1126; Antisense; TACTTGCCACCCGAAATGGTTCAGG
>probe:Drosophila_2:1627325_at:363:541; Interrogation_Position=1143; Antisense; GGTTCAGGGCAAGCCGCACACGAAA
>probe:Drosophila_2:1627325_at:557:177; Interrogation_Position=1167; Antisense; AAACGTGGATCTATGGAGCCTGGGT
>probe:Drosophila_2:1627325_at:66:643; Interrogation_Position=1196; Antisense; TCTGCTTTGAGCTGCTAGTGGGCCA
>probe:Drosophila_2:1627325_at:497:81; Interrogation_Position=1271; Antisense; AGGTGGACTACAAACTGCCGGAGCA
>probe:Drosophila_2:1627325_at:246:553; Interrogation_Position=1290; Antisense; GGAGCACATTTCCAAGGCAGCATCC
>probe:Drosophila_2:1627325_at:15:19; Interrogation_Position=1321; Antisense; ATTTCCAAGCTGCTGGTCCTTAATC
>probe:Drosophila_2:1627325_at:596:79; Interrogation_Position=1370; Antisense; AGGTGATGGTGCATCCTTGGATCCT
>probe:Drosophila_2:1627325_at:65:583; Interrogation_Position=1394; Antisense; TGGCGCACACGCAGTGAACACATTC
>probe:Drosophila_2:1627325_at:666:523; Interrogation_Position=1464; Antisense; GGGCTCCCCGCGTAATTTAATTATG
>probe:Drosophila_2:1627325_at:12:419; Interrogation_Position=988; Antisense; GAGCGGGACATCATACACAGGGACA

Paste this into a BLAST search page for me
CGGAGAACTTGCTGCTCGGGCACAAAAGGGCGTCCTGAAGATCGCCGACTACTGTGCGGCACTGTCGACTACTTGTACTTGCCACCCGAAATGGTTCAGGGGTTCAGGGCAAGCCGCACACGAAAAAACGTGGATCTATGGAGCCTGGGTTCTGCTTTGAGCTGCTAGTGGGCCAAGGTGGACTACAAACTGCCGGAGCAGGAGCACATTTCCAAGGCAGCATCCATTTCCAAGCTGCTGGTCCTTAATCAGGTGATGGTGCATCCTTGGATCCTTGGCGCACACGCAGTGAACACATTCGGGCTCCCCGCGTAATTTAATTATGGAGCGGGACATCATACACAGGGACA

Full Affymetrix probeset data:

Annotations for 1627325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720