FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627328_at:

>probe:Drosophila_2:1627328_at:8:417; Interrogation_Position=1026; Antisense; GAGCGCCTTAACTTCACTGTGGATT
>probe:Drosophila_2:1627328_at:512:335; Interrogation_Position=1058; Antisense; GCTGCACATGCACAACTGGGTGATA
>probe:Drosophila_2:1627328_at:64:471; Interrogation_Position=1094; Antisense; GTTCGAGGCCTATTTCTGCGGCGGC
>probe:Drosophila_2:1627328_at:399:719; Interrogation_Position=1128; Antisense; TTCCCGCTGGGCACCAAAATGAATG
>probe:Drosophila_2:1627328_at:481:175; Interrogation_Position=1174; Antisense; AAACCCTGATGCACCTGAAGCAGCC
>probe:Drosophila_2:1627328_at:5:597; Interrogation_Position=1218; Antisense; TGTGTGCCCACAGTTTTGGGTGCCA
>probe:Drosophila_2:1627328_at:93:593; Interrogation_Position=1234; Antisense; TGGGTGCCATCACTATTCTGCGGTA
>probe:Drosophila_2:1627328_at:618:687; Interrogation_Position=1247; Antisense; TATTCTGCGGTATCTCAATGAGGAC
>probe:Drosophila_2:1627328_at:70:75; Interrogation_Position=1267; Antisense; AGGACATCATCGACCTGACCAAATA
>probe:Drosophila_2:1627328_at:323:9; Interrogation_Position=1334; Antisense; ATTGCCTATTTCGTTTGTGATGTAC
>probe:Drosophila_2:1627328_at:520:465; Interrogation_Position=832; Antisense; GATTGGTGACACCACAGGCCAGCCG
>probe:Drosophila_2:1627328_at:114:355; Interrogation_Position=856; Antisense; GCACCAGTTTAGAGCCCTTTATTGT
>probe:Drosophila_2:1627328_at:520:703; Interrogation_Position=874; Antisense; TTATTGTCGGCTATTTCAACGGCCC
>probe:Drosophila_2:1627328_at:174:519; Interrogation_Position=996; Antisense; GTGGATCTGTACAGACCACCGCAGT

Paste this into a BLAST search page for me
GAGCGCCTTAACTTCACTGTGGATTGCTGCACATGCACAACTGGGTGATAGTTCGAGGCCTATTTCTGCGGCGGCTTCCCGCTGGGCACCAAAATGAATGAAACCCTGATGCACCTGAAGCAGCCTGTGTGCCCACAGTTTTGGGTGCCATGGGTGCCATCACTATTCTGCGGTATATTCTGCGGTATCTCAATGAGGACAGGACATCATCGACCTGACCAAATAATTGCCTATTTCGTTTGTGATGTACGATTGGTGACACCACAGGCCAGCCGGCACCAGTTTAGAGCCCTTTATTGTTTATTGTCGGCTATTTCAACGGCCCGTGGATCTGTACAGACCACCGCAGT

Full Affymetrix probeset data:

Annotations for 1627328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720