Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627329_at:

>probe:Drosophila_2:1627329_at:70:713; Interrogation_Position=5367; Antisense; TTCACGCCACTCAAGTGTGCAGCAA
>probe:Drosophila_2:1627329_at:718:367; Interrogation_Position=5409; Antisense; GAATCCATTCATACAGACAACGGCC
>probe:Drosophila_2:1627329_at:396:387; Interrogation_Position=5424; Antisense; GACAACGGCCGTCAAGTTTCACTCG
>probe:Drosophila_2:1627329_at:117:669; Interrogation_Position=5481; Antisense; TACTGGGTCCTTGGCTAGCATTTAT
>probe:Drosophila_2:1627329_at:157:677; Interrogation_Position=5496; Antisense; TAGCATTTATGCCACAACCTCGCGT
>probe:Drosophila_2:1627329_at:305:577; Interrogation_Position=5602; Antisense; GGCGCTGCCTACTATAACCACAATG
>probe:Drosophila_2:1627329_at:32:411; Interrogation_Position=5677; Antisense; GACCAAGGCCGAATTCCTCGAGAAT
>probe:Drosophila_2:1627329_at:135:367; Interrogation_Position=5698; Antisense; GAATCTCAACGCGAAGCTGGCGAAG
>probe:Drosophila_2:1627329_at:676:369; Interrogation_Position=5727; Antisense; GAATGTCTGGACGAGCATTTGCCGT
>probe:Drosophila_2:1627329_at:131:419; Interrogation_Position=5739; Antisense; GAGCATTTGCCGTGCGAAATCTCAT
>probe:Drosophila_2:1627329_at:575:395; Interrogation_Position=5754; Antisense; GAAATCTCATCAACAGCAAGGCCCT
>probe:Drosophila_2:1627329_at:166:577; Interrogation_Position=5773; Antisense; GGCCCTGATGTATCAAAATCCGCAA
>probe:Drosophila_2:1627329_at:249:411; Interrogation_Position=5808; Antisense; GACCCAGTGCGCAATACCGTAGACC
>probe:Drosophila_2:1627329_at:505:203; Interrogation_Position=5857; Antisense; AACCACCAATGCCACTTGCGAAGAT

Paste this into a BLAST search page for me
TTCACGCCACTCAAGTGTGCAGCAAGAATCCATTCATACAGACAACGGCCGACAACGGCCGTCAAGTTTCACTCGTACTGGGTCCTTGGCTAGCATTTATTAGCATTTATGCCACAACCTCGCGTGGCGCTGCCTACTATAACCACAATGGACCAAGGCCGAATTCCTCGAGAATGAATCTCAACGCGAAGCTGGCGAAGGAATGTCTGGACGAGCATTTGCCGTGAGCATTTGCCGTGCGAAATCTCATGAAATCTCATCAACAGCAAGGCCCTGGCCCTGATGTATCAAAATCCGCAAGACCCAGTGCGCAATACCGTAGACCAACCACCAATGCCACTTGCGAAGAT

Full Affymetrix probeset data:

Annotations for 1627329_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime