FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627330_at:

>probe:Drosophila_2:1627330_at:479:599; Interrogation_Position=1024; Antisense; TGTCAATTCCAATCCAGAGCAGTCC
>probe:Drosophila_2:1627330_at:200:103; Interrogation_Position=1039; Antisense; AGAGCAGTCCTCTTGTGTTCACTGT
>probe:Drosophila_2:1627330_at:425:473; Interrogation_Position=1055; Antisense; GTTCACTGTCGATCTACACTGGACT
>probe:Drosophila_2:1627330_at:729:683; Interrogation_Position=1086; Antisense; TATCCGACACTCTGCTGGCTATTGA
>probe:Drosophila_2:1627330_at:387:431; Interrogation_Position=1109; Antisense; GAGTACTCCAGATCTGTTTCAGAGG
>probe:Drosophila_2:1627330_at:635:91; Interrogation_Position=1129; Antisense; AGAGGCCGGCGTGAGCCTGTACAAA
>probe:Drosophila_2:1627330_at:132:187; Interrogation_Position=1196; Antisense; AACAAGGACGGTTTGTGCCACGCAT
>probe:Drosophila_2:1627330_at:84:659; Interrogation_Position=699; Antisense; TAAGTGTTGACTTAGCCACCCAGCT
>probe:Drosophila_2:1627330_at:43:427; Interrogation_Position=798; Antisense; GAGATGTTAAGCTGCTGCGACCTCT
>probe:Drosophila_2:1627330_at:456:615; Interrogation_Position=862; Antisense; TGCACAGCGTCTAAAGCCACATTTT
>probe:Drosophila_2:1627330_at:240:425; Interrogation_Position=920; Antisense; GAGACTGCCAGCTTACAGAACCTTA
>probe:Drosophila_2:1627330_at:252:107; Interrogation_Position=936; Antisense; AGAACCTTACATCAGCCTTTGTGGC
>probe:Drosophila_2:1627330_at:458:125; Interrogation_Position=949; Antisense; AGCCTTTGTGGCCAATCTGCAGCAA
>probe:Drosophila_2:1627330_at:717:627; Interrogation_Position=983; Antisense; TCCACAGTATCCACAGTGTTCCGAA

Paste this into a BLAST search page for me
TGTCAATTCCAATCCAGAGCAGTCCAGAGCAGTCCTCTTGTGTTCACTGTGTTCACTGTCGATCTACACTGGACTTATCCGACACTCTGCTGGCTATTGAGAGTACTCCAGATCTGTTTCAGAGGAGAGGCCGGCGTGAGCCTGTACAAAAACAAGGACGGTTTGTGCCACGCATTAAGTGTTGACTTAGCCACCCAGCTGAGATGTTAAGCTGCTGCGACCTCTTGCACAGCGTCTAAAGCCACATTTTGAGACTGCCAGCTTACAGAACCTTAAGAACCTTACATCAGCCTTTGTGGCAGCCTTTGTGGCCAATCTGCAGCAATCCACAGTATCCACAGTGTTCCGAA

Full Affymetrix probeset data:

Annotations for 1627330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720