Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627331_at:

>probe:Drosophila_2:1627331_at:170:489; Interrogation_Position=1782; Antisense; GTACGCCTGATGACGGGCCACAAGG
>probe:Drosophila_2:1627331_at:720:217; Interrogation_Position=1803; Antisense; AAGGGATCGGTGAGTTCTCTGGCCT
>probe:Drosophila_2:1627331_at:197:581; Interrogation_Position=1849; Antisense; TGGCCTCGGGTTCAGTAGATCACAA
>probe:Drosophila_2:1627331_at:652:35; Interrogation_Position=1875; Antisense; ATCATCATCTGGGATCTGTCGAACG
>probe:Drosophila_2:1627331_at:646:467; Interrogation_Position=1919; Antisense; GTTGAGGCACACTAGCACTGTGACC
>probe:Drosophila_2:1627331_at:577:259; Interrogation_Position=1943; Antisense; CACGATCACCTTTAGTCGCGATGGA
>probe:Drosophila_2:1627331_at:418:327; Interrogation_Position=1960; Antisense; GCGATGGAACAGTCCTGGCTGCAGC
>probe:Drosophila_2:1627331_at:424:573; Interrogation_Position=1976; Antisense; GGCTGCAGCCGGCTTGGATAACAAT
>probe:Drosophila_2:1627331_at:577:159; Interrogation_Position=1996; Antisense; ACAATCTAACTCTGTGGGACTTTCA
>probe:Drosophila_2:1627331_at:563:259; Interrogation_Position=2054; Antisense; CACTGTGTCGCACCATCAGGATGAG
>probe:Drosophila_2:1627331_at:548:73; Interrogation_Position=2086; Antisense; AGGACGTCTACCTCATGCGTACTTT
>probe:Drosophila_2:1627331_at:404:211; Interrogation_Position=2118; Antisense; AAGAACTCGCCATTTGTCAGCCTGC
>probe:Drosophila_2:1627331_at:334:165; Interrogation_Position=2156; Antisense; AAATCTCCTGATGTGCGTGGGTCTA
>probe:Drosophila_2:1627331_at:118:723; Interrogation_Position=2265; Antisense; TTGTATTTCGTTTGTGACCCATCCC

Paste this into a BLAST search page for me
GTACGCCTGATGACGGGCCACAAGGAAGGGATCGGTGAGTTCTCTGGCCTTGGCCTCGGGTTCAGTAGATCACAAATCATCATCTGGGATCTGTCGAACGGTTGAGGCACACTAGCACTGTGACCCACGATCACCTTTAGTCGCGATGGAGCGATGGAACAGTCCTGGCTGCAGCGGCTGCAGCCGGCTTGGATAACAATACAATCTAACTCTGTGGGACTTTCACACTGTGTCGCACCATCAGGATGAGAGGACGTCTACCTCATGCGTACTTTAAGAACTCGCCATTTGTCAGCCTGCAAATCTCCTGATGTGCGTGGGTCTATTGTATTTCGTTTGTGACCCATCCC

Full Affymetrix probeset data:

Annotations for 1627331_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime