FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627333_at:

>probe:Drosophila_2:1627333_at:438:357; Interrogation_Position=1065; Antisense; GCAAAGTCACACACGGCGTATACAT
>probe:Drosophila_2:1627333_at:326:613; Interrogation_Position=614; Antisense; TGAAAAAATCTCAGCTGCCTTCCGC
>probe:Drosophila_2:1627333_at:409:313; Interrogation_Position=639; Antisense; GCCACCAGGTTCTTTCACAAAGCGA
>probe:Drosophila_2:1627333_at:85:281; Interrogation_Position=670; Antisense; CTCCCCATCTAAGCCGTGAAGTATG
>probe:Drosophila_2:1627333_at:348:253; Interrogation_Position=696; Antisense; CAACGCCGCAATGCCGACAATTGGT
>probe:Drosophila_2:1627333_at:473:393; Interrogation_Position=711; Antisense; GACAATTGGTACTCTCGTTTGGCGC
>probe:Drosophila_2:1627333_at:342:479; Interrogation_Position=727; Antisense; GTTTGGCGCCAATACTAACGACAAC
>probe:Drosophila_2:1627333_at:193:353; Interrogation_Position=768; Antisense; GCACTCTGGCGAGAGGGCACGTCAA
>probe:Drosophila_2:1627333_at:682:509; Interrogation_Position=793; Antisense; GTGCAGAGAGAGTCCGAACCCGAGT
>probe:Drosophila_2:1627333_at:642:189; Interrogation_Position=863; Antisense; AACATTTGCCGGCTGCTTAGTTTTT
>probe:Drosophila_2:1627333_at:412:417; Interrogation_Position=912; Antisense; GAGCGAACGCTGAAAGCTTCCACTC
>probe:Drosophila_2:1627333_at:38:643; Interrogation_Position=935; Antisense; TCTCCCTCCGCGATTTAGATTTAGA
>probe:Drosophila_2:1627333_at:322:699; Interrogation_Position=972; Antisense; TTTACATTCACATTCACGTTCGCAC
>probe:Drosophila_2:1627333_at:675:469; Interrogation_Position=989; Antisense; GTTCGCACTCAGATTCCGATTTCGA

Paste this into a BLAST search page for me
GCAAAGTCACACACGGCGTATACATTGAAAAAATCTCAGCTGCCTTCCGCGCCACCAGGTTCTTTCACAAAGCGACTCCCCATCTAAGCCGTGAAGTATGCAACGCCGCAATGCCGACAATTGGTGACAATTGGTACTCTCGTTTGGCGCGTTTGGCGCCAATACTAACGACAACGCACTCTGGCGAGAGGGCACGTCAAGTGCAGAGAGAGTCCGAACCCGAGTAACATTTGCCGGCTGCTTAGTTTTTGAGCGAACGCTGAAAGCTTCCACTCTCTCCCTCCGCGATTTAGATTTAGATTTACATTCACATTCACGTTCGCACGTTCGCACTCAGATTCCGATTTCGA

Full Affymetrix probeset data:

Annotations for 1627333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720