FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627334_at:

>probe:Drosophila_2:1627334_at:506:345; Interrogation_Position=1725; Antisense; GCATTTCAATTAATTTTTGCCACAT
>probe:Drosophila_2:1627334_at:728:699; Interrogation_Position=1739; Antisense; TTTTGCCACATATTTGTTGTACGAT
>probe:Drosophila_2:1627334_at:23:467; Interrogation_Position=1754; Antisense; GTTGTACGATATTGGGACAATCCAG
>probe:Drosophila_2:1627334_at:251:49; Interrogation_Position=1773; Antisense; ATCCAGATAGTTTGGTTCTGCCAGT
>probe:Drosophila_2:1627334_at:189:561; Interrogation_Position=1844; Antisense; GGAAACTGCTAAAAGTCTGAGAACT
>probe:Drosophila_2:1627334_at:49:499; Interrogation_Position=1858; Antisense; GTCTGAGAACTGTATATCATGATGA
>probe:Drosophila_2:1627334_at:253:459; Interrogation_Position=1889; Antisense; GATATTCTGTGAACATTTACATATG
>probe:Drosophila_2:1627334_at:222:541; Interrogation_Position=1954; Antisense; GGTTTTCATGTATTGCATTTTCTTC
>probe:Drosophila_2:1627334_at:44:345; Interrogation_Position=1968; Antisense; GCATTTTCTTCAGATAAGTAGCAAT
>probe:Drosophila_2:1627334_at:490:179; Interrogation_Position=2005; Antisense; AAACATTTTATCACAGTACAGACAA
>probe:Drosophila_2:1627334_at:360:363; Interrogation_Position=2080; Antisense; GAATTTACAATTTTCATATCGACTT
>probe:Drosophila_2:1627334_at:376:485; Interrogation_Position=2109; Antisense; GTAGATTAACTTCGAGGCTTTACAA
>probe:Drosophila_2:1627334_at:171:499; Interrogation_Position=2190; Antisense; GTCTACAAGTCTAGTCAACTTCCGA
>probe:Drosophila_2:1627334_at:366:147; Interrogation_Position=2207; Antisense; ACTTCCGAATATTATGTTGGTAACT

Paste this into a BLAST search page for me
GCATTTCAATTAATTTTTGCCACATTTTTGCCACATATTTGTTGTACGATGTTGTACGATATTGGGACAATCCAGATCCAGATAGTTTGGTTCTGCCAGTGGAAACTGCTAAAAGTCTGAGAACTGTCTGAGAACTGTATATCATGATGAGATATTCTGTGAACATTTACATATGGGTTTTCATGTATTGCATTTTCTTCGCATTTTCTTCAGATAAGTAGCAATAAACATTTTATCACAGTACAGACAAGAATTTACAATTTTCATATCGACTTGTAGATTAACTTCGAGGCTTTACAAGTCTACAAGTCTAGTCAACTTCCGAACTTCCGAATATTATGTTGGTAACT

Full Affymetrix probeset data:

Annotations for 1627334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720