FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627337_at:

>probe:Drosophila_2:1627337_at:290:263; Interrogation_Position=259; Antisense; CAGCGAGGACGCAAGGCAGTTCATG
>probe:Drosophila_2:1627337_at:256:329; Interrogation_Position=289; Antisense; GCGTCAGAAGAACCACCGTCGAAAT
>probe:Drosophila_2:1627337_at:122:167; Interrogation_Position=310; Antisense; AAATGTCATAGAAGCCAACCGGTCG
>probe:Drosophila_2:1627337_at:488:253; Interrogation_Position=325; Antisense; CAACCGGTCGCAGGATACTACATGG
>probe:Drosophila_2:1627337_at:270:663; Interrogation_Position=340; Antisense; TACTACATGGGAGCCCTTCAACGAT
>probe:Drosophila_2:1627337_at:413:439; Interrogation_Position=362; Antisense; GATGAGAAGCCCTCCACGGAAAGAA
>probe:Drosophila_2:1627337_at:710:387; Interrogation_Position=384; Antisense; GAAAACAACAGCTCTCCACGGACGT
>probe:Drosophila_2:1627337_at:669:245; Interrogation_Position=400; Antisense; CACGGACGTTGAGAACTTCACTTTT
>probe:Drosophila_2:1627337_at:235:209; Interrogation_Position=446; Antisense; AAGCAACTCACTTTGGGTTTCAATT
>probe:Drosophila_2:1627337_at:557:357; Interrogation_Position=485; Antisense; GCAACACTTAAATCTGCCCTAAAGG
>probe:Drosophila_2:1627337_at:630:537; Interrogation_Position=608; Antisense; GGTAGCCATCCCTTTCAGAAAATGC
>probe:Drosophila_2:1627337_at:342:631; Interrogation_Position=679; Antisense; TCCGTTTCAGAAAGGGCCACATAAT
>probe:Drosophila_2:1627337_at:632:703; Interrogation_Position=712; Antisense; TTAGCTTATTTTCCCTTAGGTGACT
>probe:Drosophila_2:1627337_at:599:693; Interrogation_Position=727; Antisense; TTAGGTGACTTCACAACCCCAACTG

Paste this into a BLAST search page for me
CAGCGAGGACGCAAGGCAGTTCATGGCGTCAGAAGAACCACCGTCGAAATAAATGTCATAGAAGCCAACCGGTCGCAACCGGTCGCAGGATACTACATGGTACTACATGGGAGCCCTTCAACGATGATGAGAAGCCCTCCACGGAAAGAAGAAAACAACAGCTCTCCACGGACGTCACGGACGTTGAGAACTTCACTTTTAAGCAACTCACTTTGGGTTTCAATTGCAACACTTAAATCTGCCCTAAAGGGGTAGCCATCCCTTTCAGAAAATGCTCCGTTTCAGAAAGGGCCACATAATTTAGCTTATTTTCCCTTAGGTGACTTTAGGTGACTTCACAACCCCAACTG

Full Affymetrix probeset data:

Annotations for 1627337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720