FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627339_at:

>probe:Drosophila_2:1627339_at:529:5; Interrogation_Position=124; Antisense; ATTGCAGCGGTGGTATACAGTCCTA
>probe:Drosophila_2:1627339_at:309:593; Interrogation_Position=219; Antisense; TGGGAAGCCGGACTCTGATCGAACT
>probe:Drosophila_2:1627339_at:619:635; Interrogation_Position=237; Antisense; TCGAACTGCACCTGATACCACTGAA
>probe:Drosophila_2:1627339_at:622:613; Interrogation_Position=258; Antisense; TGAACCCCTAACCTCTGGTGATATT
>probe:Drosophila_2:1627339_at:27:515; Interrogation_Position=275; Antisense; GTGATATTCCAACCCCAGATGTCAA
>probe:Drosophila_2:1627339_at:321:135; Interrogation_Position=374; Antisense; ACGCACCTCAGGGTCTATCGAAGAA
>probe:Drosophila_2:1627339_at:685:687; Interrogation_Position=408; Antisense; TATATTGCCCTATCTGGAGGTCAGC
>probe:Drosophila_2:1627339_at:385:549; Interrogation_Position=423; Antisense; GGAGGTCAGCTTTTTGTCCTGGCCA
>probe:Drosophila_2:1627339_at:396:291; Interrogation_Position=449; Antisense; CGTTTTGGATTTGGCGCGGCTACAA
>probe:Drosophila_2:1627339_at:528:665; Interrogation_Position=469; Antisense; TACAACTGGCAGTCCGCACGAAAAA
>probe:Drosophila_2:1627339_at:472:707; Interrogation_Position=559; Antisense; TTAGCCACTGGTCTGTTCACGATAT
>probe:Drosophila_2:1627339_at:86:21; Interrogation_Position=580; Antisense; ATATCAATGGGTCGACCTGCCGGCA
>probe:Drosophila_2:1627339_at:88:391; Interrogation_Position=643; Antisense; GAAACAGCTGACATCGGAGACTCCT
>probe:Drosophila_2:1627339_at:591:463; Interrogation_Position=73; Antisense; GATTCGCTGCTCCAGAAGATCTCAG

Paste this into a BLAST search page for me
ATTGCAGCGGTGGTATACAGTCCTATGGGAAGCCGGACTCTGATCGAACTTCGAACTGCACCTGATACCACTGAATGAACCCCTAACCTCTGGTGATATTGTGATATTCCAACCCCAGATGTCAAACGCACCTCAGGGTCTATCGAAGAATATATTGCCCTATCTGGAGGTCAGCGGAGGTCAGCTTTTTGTCCTGGCCACGTTTTGGATTTGGCGCGGCTACAATACAACTGGCAGTCCGCACGAAAAATTAGCCACTGGTCTGTTCACGATATATATCAATGGGTCGACCTGCCGGCAGAAACAGCTGACATCGGAGACTCCTGATTCGCTGCTCCAGAAGATCTCAG

Full Affymetrix probeset data:

Annotations for 1627339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720