Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627345_at:

>probe:Drosophila_2:1627345_at:465:725; Interrogation_Position=100; Antisense; TTGACCATCGATCCAACTTTGGCAT
>probe:Drosophila_2:1627345_at:683:327; Interrogation_Position=166; Antisense; GCGTTTCCCATCAAGCAGGCGGATA
>probe:Drosophila_2:1627345_at:409:463; Interrogation_Position=209; Antisense; GATTCGTCAACTACCAGGCGCAATA
>probe:Drosophila_2:1627345_at:369:317; Interrogation_Position=243; Antisense; GCCTGTCCCAATTTACTGGTGGAGT
>probe:Drosophila_2:1627345_at:4:431; Interrogation_Position=264; Antisense; GAGTTTCTGGAACACCTCGACATTT
>probe:Drosophila_2:1627345_at:204:347; Interrogation_Position=317; Antisense; GCATCCGGAGCAGGGTTTTCCAGGA
>probe:Drosophila_2:1627345_at:651:103; Interrogation_Position=344; Antisense; AGACCCGAGTTTGGCTGTACGATGT
>probe:Drosophila_2:1627345_at:47:21; Interrogation_Position=396; Antisense; ATTTGATGGCTCATCTGTCATCGCC
>probe:Drosophila_2:1627345_at:341:599; Interrogation_Position=411; Antisense; TGTCATCGCCTTTTACTGGTTTATT
>probe:Drosophila_2:1627345_at:580:689; Interrogation_Position=432; Antisense; TATTCGTGTTGCAGGCTCGGAGATC
>probe:Drosophila_2:1627345_at:357:317; Interrogation_Position=468; Antisense; GCCTGCCTGCTCAAATGTATCTGTG
>probe:Drosophila_2:1627345_at:589:483; Interrogation_Position=484; Antisense; GTATCTGTGAGATATCCCAACGCCC
>probe:Drosophila_2:1627345_at:497:17; Interrogation_Position=525; Antisense; ATTTTTGTATCTGCATGCCCGGAAT
>probe:Drosophila_2:1627345_at:323:207; Interrogation_Position=557; Antisense; AAGCTGGTGCCAATTGCCGGAAAAC

Paste this into a BLAST search page for me
TTGACCATCGATCCAACTTTGGCATGCGTTTCCCATCAAGCAGGCGGATAGATTCGTCAACTACCAGGCGCAATAGCCTGTCCCAATTTACTGGTGGAGTGAGTTTCTGGAACACCTCGACATTTGCATCCGGAGCAGGGTTTTCCAGGAAGACCCGAGTTTGGCTGTACGATGTATTTGATGGCTCATCTGTCATCGCCTGTCATCGCCTTTTACTGGTTTATTTATTCGTGTTGCAGGCTCGGAGATCGCCTGCCTGCTCAAATGTATCTGTGGTATCTGTGAGATATCCCAACGCCCATTTTTGTATCTGCATGCCCGGAATAAGCTGGTGCCAATTGCCGGAAAAC

Full Affymetrix probeset data:

Annotations for 1627345_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime